Incidental Mutation 'R7258:Ccr5'
ID564431
Institutional Source Beutler Lab
Gene Symbol Ccr5
Ensembl Gene ENSMUSG00000079227
Gene Namechemokine (C-C motif) receptor 5
SynonymsCmkbr5, CD195
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7258 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location124121543-124147699 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 124125274 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 305 (K305*)
Ref Sequence ENSEMBL: ENSMUSP00000107069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111442] [ENSMUST00000168179] [ENSMUST00000171499]
Predicted Effect probably benign
Transcript: ENSMUST00000097855
Predicted Effect probably null
Transcript: ENSMUST00000111442
AA Change: K305*
SMART Domains Protein: ENSMUSP00000107069
Gene: ENSMUSG00000079227
AA Change: K305*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 314 3.8e-6 PFAM
Pfam:7tm_1 49 299 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168179
Predicted Effect probably benign
Transcript: ENSMUST00000171499
SMART Domains Protein: ENSMUSP00000127328
Gene: ENSMUSG00000079227

DomainStartEndE-ValueType
Pfam:7tm_1 49 123 1.1e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice that are homozygous for null alleles have leukocytes with defective migration and adhesion, are more susceptibility to fungal & bacterial infections, have increased length of allograft survival, and have decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Ccr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ccr5 APN 9 124124406 missense possibly damaging 0.59
IGL00551:Ccr5 APN 9 124124588 missense probably damaging 1.00
IGL01153:Ccr5 APN 9 124124612 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0355:Ccr5 UTSW 9 124124914 missense possibly damaging 0.90
R1570:Ccr5 UTSW 9 124124963 missense probably benign 0.29
R4305:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4307:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4570:Ccr5 UTSW 9 124124875 nonsense probably null
R4589:Ccr5 UTSW 9 124124502 missense probably benign 0.00
R5549:Ccr5 UTSW 9 124125371 missense probably benign 0.09
R5566:Ccr5 UTSW 9 124124660 missense probably benign 0.07
R5871:Ccr5 UTSW 9 124124521 missense probably benign 0.02
R6568:Ccr5 UTSW 9 124125199 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTGAGGCTCATCTTTGC -3'
(R):5'- CCTACTCCCAAGCTGCATAG -3'

Sequencing Primer
(F):5'- GCTCATCTTTGCCATCATGATTG -3'
(R):5'- GCTGCATAGAAAAACTACGTGATAC -3'
Posted On2019-06-26