Incidental Mutation 'R7258:Epb41l2'
ID564432
Institutional Source Beutler Lab
Gene Symbol Epb41l2
Ensembl Gene ENSMUSG00000019978
Gene Nameerythrocyte membrane protein band 4.1 like 2
SynonymsNBL2, 4.1G, Epb4.1l2, D10Ertd398e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R7258 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location25359798-25523519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25484287 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 516 (A516T)
Ref Sequence ENSEMBL: ENSMUSP00000055122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053748] [ENSMUST00000092645] [ENSMUST00000217929] [ENSMUST00000218903] [ENSMUST00000219805] [ENSMUST00000219900]
Predicted Effect probably damaging
Transcript: ENSMUST00000053748
AA Change: A516T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055122
Gene: ENSMUSG00000019978
AA Change: A516T

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 1.8e-23 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 875 981 1.1e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092645
AA Change: A516T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090314
Gene: ENSMUSG00000019978
AA Change: A516T

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 6.1e-27 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 869 982 8.2e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217929
AA Change: A516T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218903
AA Change: A516T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000219805
Predicted Effect probably benign
Transcript: ENSMUST00000219900
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal glutamatergic synapse formation, AMPAR responses and long-term potentiation. Male mice homozygous for a knock-out allele exhibit normal fertility. Male mice homozygous for a gene trap allele on a mixed background are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm281 A T 14: 13,899,648 F91L Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Epb41l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Epb41l2 APN 10 25501836 missense probably damaging 1.00
IGL00826:Epb41l2 APN 10 25441722 missense probably benign 0.07
IGL01312:Epb41l2 APN 10 25441587 start codon destroyed probably null 1.00
IGL02123:Epb41l2 APN 10 25460844 missense probably damaging 1.00
IGL02448:Epb41l2 APN 10 25493595 missense possibly damaging 0.66
R0365:Epb41l2 UTSW 10 25469221 missense probably damaging 1.00
R0594:Epb41l2 UTSW 10 25443770 missense possibly damaging 0.53
R0826:Epb41l2 UTSW 10 25504192 missense probably damaging 1.00
R0837:Epb41l2 UTSW 10 25507816 missense probably damaging 1.00
R1243:Epb41l2 UTSW 10 25489043 missense possibly damaging 0.81
R1301:Epb41l2 UTSW 10 25443902 missense probably damaging 1.00
R1560:Epb41l2 UTSW 10 25495436 splice site probably null
R1752:Epb41l2 UTSW 10 25460792 missense probably damaging 1.00
R1813:Epb41l2 UTSW 10 25441568 splice site probably null
R1966:Epb41l2 UTSW 10 25441768 missense probably benign 0.01
R2276:Epb41l2 UTSW 10 25488944 unclassified probably benign
R4425:Epb41l2 UTSW 10 25506180 missense possibly damaging 0.81
R4445:Epb41l2 UTSW 10 25443803 missense possibly damaging 0.92
R4621:Epb41l2 UTSW 10 25502140 critical splice donor site probably null
R4720:Epb41l2 UTSW 10 25471626 missense probably damaging 1.00
R5026:Epb41l2 UTSW 10 25484308 missense possibly damaging 0.94
R5408:Epb41l2 UTSW 10 25468094 critical splice acceptor site probably null
R5703:Epb41l2 UTSW 10 25441767 missense probably damaging 1.00
R5896:Epb41l2 UTSW 10 25493596 missense probably damaging 0.96
R5974:Epb41l2 UTSW 10 25441815 missense possibly damaging 0.79
R6073:Epb41l2 UTSW 10 25501832 missense probably damaging 1.00
R6182:Epb41l2 UTSW 10 25507817 missense probably damaging 1.00
R6229:Epb41l2 UTSW 10 25499836 missense possibly damaging 0.73
R6276:Epb41l2 UTSW 10 25502124 missense probably damaging 0.98
R6321:Epb41l2 UTSW 10 25468128 missense probably damaging 0.98
R6737:Epb41l2 UTSW 10 25489018 splice site probably null
R6766:Epb41l2 UTSW 10 25473092 nonsense probably null
R6834:Epb41l2 UTSW 10 25493604 missense possibly damaging 0.92
R7023:Epb41l2 UTSW 10 25512977 missense probably damaging 1.00
R7688:Epb41l2 UTSW 10 25479138 missense probably damaging 0.97
R7769:Epb41l2 UTSW 10 25493573 missense probably benign
R7796:Epb41l2 UTSW 10 25443829 missense probably benign 0.15
R8365:Epb41l2 UTSW 10 25441686 missense probably benign 0.21
Z1176:Epb41l2 UTSW 10 25441720 missense probably benign 0.03
Z1176:Epb41l2 UTSW 10 25499902 nonsense probably null
Z1177:Epb41l2 UTSW 10 25479741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAGGCCAACTTGTCTC -3'
(R):5'- CTCTAGAGGGTGTCTCATGGTC -3'

Sequencing Primer
(F):5'- TTGGAGGCCAACTTGTCTCAAAAAC -3'
(R):5'- AGAGGGTGTCTCATGGTCTTATGAC -3'
Posted On2019-06-26