Mutagenetix > Incidental Mutation

Incidental Mutation 'R7258:Pcsk1'

564443

Institutional Source

Beutler Lab

Gene Symbol

Pcsk1

Ensembl Gene

ENSMUSG00000021587

Gene Name

proprotein convertase subtilisin/kexin type 1

Synonyms

PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7258 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75089826-75134861 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 75093186 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 95 (R95H)

Ref Sequence

ENSEMBL: ENSMUSP00000022075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022075]

AlphaFold

P63239

PDB Structure

Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022075
AA Change: R95H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: R95H

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:S8_pro-domain	34	110	6.4e-26	PFAM
Pfam:Peptidase_S8	158	442	2.2e-49	PFAM
Pfam:P_proprotein	504	591	6.1e-30	PFAM
low complexity region	679	694	N/A	INTRINSIC
Pfam:Proho_convert	713	751	4.3e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110079O15Rik	A	C	1: 87,475,067	I40L	probably benign	Het
4933402J07Rik	A	C	8: 87,586,177	S197R	probably damaging	Het
Abcc12	T	C	8: 86,560,857	R120G	possibly damaging	Het
Abhd14b	A	G	9: 106,450,219	I67V	probably benign	Het
Alpk1	A	T	3: 127,724,466	V62E	probably damaging	Het
Ankar	A	G	1: 72,651,727	V1196A	probably benign	Het
B230118H07Rik	T	C	2: 101,610,592	D22G	probably null	Het
Ccr5	A	T	9: 124,125,274	K305*	probably null	Het
Cdc42bpb	T	C	12: 111,326,084	H339R	probably damaging	Het
Cep290	T	G	10: 100,499,108	M330R	probably benign	Het
Cyfip2	T	C	11: 46,224,177	Y901C	probably benign	Het
Ddx54	T	G	5: 120,620,747	Y352D	probably damaging	Het
Defa35	A	T	8: 21,065,229	H55L	possibly damaging	Het
Dnmt3b	T	A	2: 153,683,599		probably null	Het
Enpep	A	C	3: 129,332,075	L136R	probably benign	Het
Epb41l2	G	A	10: 25,484,287	A516T	probably damaging	Het
Frmd4a	A	T	2: 4,300,953	Q13L	probably benign	Het
Frmpd1	C	A	4: 45,269,974	D271E	possibly damaging	Het
Gbp5	T	A	3: 142,506,781	L410H	probably damaging	Het
Gipc2	T	C	3: 152,165,715	E58G	probably damaging	Het
Gm281	A	T	14: 13,899,648	F91L		Het
Gm6309	A	T	5: 146,168,296	V269E	probably benign	Het
Grm5	A	T	7: 88,074,706	T735S	probably damaging	Het
H6pd	T	C	4: 149,996,362	M9V	probably benign	Het
Hmcn1	A	G	1: 150,715,823	I1875T	probably benign	Het
Hrc	T	A	7: 45,336,296	D290E	possibly damaging	Het
Ippk	C	A	13: 49,433,862	Q136K	probably benign	Het
Kcnv1	T	C	15: 45,109,315	T391A	probably damaging	Het
Kdm5b	A	C	1: 134,621,021	E1088A	probably damaging	Het
L1td1	C	T	4: 98,736,864	A432V	probably benign	Het
Ly86	A	G	13: 37,345,497	D20G	probably benign	Het
Myo1g	A	G	11: 6,509,416	I818T	possibly damaging	Het
Nms	A	G	1: 38,946,970	T121A	probably benign	Het
Olfr1084	T	A	2: 86,639,001	K236*	probably null	Het
Olfr1414	A	T	1: 92,511,176	I284N	possibly damaging	Het
Olfr350	T	A	2: 36,850,340	I98K	probably damaging	Het
Olfr391-ps	T	G	11: 73,799,380	I126L	probably damaging	Het
Olfr609	G	C	7: 103,492,589	C96W	probably damaging	Het
Olfr816	T	A	10: 129,912,287		probably benign	Het
Pcdhb9	T	C	18: 37,402,114	L387P	probably damaging	Het
Pde11a	T	C	2: 76,139,906	D502G	possibly damaging	Het
Plekhg2	T	C	7: 28,364,778	D446G	probably benign	Het
Ptch1	T	C	13: 63,573,294	K54E	not run	Het
Rasal2	A	T	1: 157,157,700	L826M	probably damaging	Het
Rnf213	A	G	11: 119,452,575	I3589V		Het
Sin3b	T	C	8: 72,750,208	C757R	probably benign	Het
Slc41a1	T	A	1: 131,842,042	V300D	probably benign	Het
Snrpa1	T	C	7: 66,070,143	F162L	probably damaging	Het
Sox30	C	A	11: 45,980,552	A78E	unknown	Het
Ssc4d	G	T	5: 135,963,087	A401E	probably damaging	Het
Steap3	A	G	1: 120,243,986	F130L	possibly damaging	Het
Stx5a	A	G	19: 8,754,907		probably null	Het
Tgfbr2	A	T	9: 116,129,830	I172N	probably damaging	Het
Tgm4	A	G	9: 123,062,491	D557G	probably benign	Het
Tmprss11c	A	G	5: 86,271,413	S96P	probably damaging	Het
Trpa1	T	G	1: 14,903,249	T282P	probably damaging	Het
Uba5	A	T	9: 104,062,933	V5E	unknown	Het
Ugt2b36	A	T	5: 87,080,903	L427H	probably damaging	Het
Utp14b	T	A	1: 78,664,974	H196Q	probably benign	Het
Vmn2r44	T	A	7: 8,377,849	L348F	probably damaging	Het
Vmn2r93	T	G	17: 18,305,141	L354V	probably benign	Het
Wwc2	T	A	8: 47,842,999	N1079Y	unknown	Het
Zfp653	T	C	9: 22,065,820	D145G	probably benign	Het
Zfp777	T	C	6: 48,025,797	E453G	probably damaging	Het
Zfp936	T	A	7: 43,190,379	H423Q	probably damaging	Het
Zfyve9	A	T	4: 108,656,954	Y496N	possibly damaging	Het

Other mutations in Pcsk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Pcsk1	APN	13	75132087	missense	probably benign
IGL01554:Pcsk1	APN	13	75132307	missense	probably benign
IGL01960:Pcsk1	APN	13	75093167	missense	possibly damaging	0.82
IGL02026:Pcsk1	APN	13	75112653	missense	probably benign	0.16
IGL02047:Pcsk1	APN	13	75097989	missense	probably benign	0.33
IGL02264:Pcsk1	APN	13	75105959	missense	probably damaging	1.00
IGL02441:Pcsk1	APN	13	75132163	missense	probably benign	0.16
IGL02795:Pcsk1	APN	13	75112620	missense	probably damaging	1.00
IGL02829:Pcsk1	APN	13	75126836	missense	probably damaging	1.00
IGL03116:Pcsk1	APN	13	75132216	missense	probably damaging	0.99
IGL03156:Pcsk1	APN	13	75131951	missense	probably benign
clipper	UTSW	13	75130070	missense	probably damaging	1.00
spareribs	UTSW	13	75115255	missense	possibly damaging	0.88
swivel	UTSW	13	75125984	missense	probably damaging	1.00
Tweeze	UTSW	13	75126839	missense	probably benign	0.00
PIT4453001:Pcsk1	UTSW	13	75112650	missense	probably damaging	1.00
R0771:Pcsk1	UTSW	13	75132162	missense	probably benign	0.31
R0894:Pcsk1	UTSW	13	75097977	missense	probably damaging	1.00
R1014:Pcsk1	UTSW	13	75132234	missense	probably damaging	1.00
R1035:Pcsk1	UTSW	13	75132119	missense	probably benign
R1199:Pcsk1	UTSW	13	75096413	splice site	probably benign
R1517:Pcsk1	UTSW	13	75098047	nonsense	probably null
R1625:Pcsk1	UTSW	13	75126852	missense	probably benign	0.11
R1691:Pcsk1	UTSW	13	75132225	missense	possibly damaging	0.65
R1717:Pcsk1	UTSW	13	75110828	missense	probably damaging	0.99
R2168:Pcsk1	UTSW	13	75112534	intron	probably benign
R2252:Pcsk1	UTSW	13	75126726	missense	probably benign	0.00
R2400:Pcsk1	UTSW	13	75090126	missense	probably benign	0.00
R4110:Pcsk1	UTSW	13	75096369	missense	probably damaging	0.99
R4358:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4359:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4657:Pcsk1	UTSW	13	75132235	missense	probably damaging	1.00
R5195:Pcsk1	UTSW	13	75126855	missense	probably damaging	1.00
R5669:Pcsk1	UTSW	13	75130102	missense	probably benign	0.01
R5671:Pcsk1	UTSW	13	75097907	missense	possibly damaging	0.63
R5745:Pcsk1	UTSW	13	75131960	missense	probably benign	0.03
R6107:Pcsk1	UTSW	13	75127848	missense	probably benign	0.09
R6200:Pcsk1	UTSW	13	75115255	missense	possibly damaging	0.88
R6326:Pcsk1	UTSW	13	75132179	missense	possibly damaging	0.89
R6537:Pcsk1	UTSW	13	75132239	missense	probably damaging	1.00
R6541:Pcsk1	UTSW	13	75125984	missense	probably damaging	1.00
R6567:Pcsk1	UTSW	13	75130070	missense	probably damaging	1.00
R6723:Pcsk1	UTSW	13	75093069	splice site	probably null
R7357:Pcsk1	UTSW	13	75125960	missense	probably damaging	0.96
R7487:Pcsk1	UTSW	13	75110883	missense	probably benign	0.01
R7519:Pcsk1	UTSW	13	75110865	missense	probably damaging	0.99
R7647:Pcsk1	UTSW	13	75132210	missense	possibly damaging	0.73
R7787:Pcsk1	UTSW	13	75132158	missense	possibly damaging	0.88
R7944:Pcsk1	UTSW	13	75132092	missense	probably benign
R7945:Pcsk1	UTSW	13	75132092	missense	probably benign
R7961:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8009:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8022:Pcsk1	UTSW	13	75099293	missense	possibly damaging	0.77
R8171:Pcsk1	UTSW	13	75090091	nonsense	probably null
R8489:Pcsk1	UTSW	13	75126002	missense	probably damaging	1.00
R9310:Pcsk1	UTSW	13	75090072	missense	probably benign
R9404:Pcsk1	UTSW	13	75132223	missense	probably benign	0.11
R9544:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9588:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9706:Pcsk1	UTSW	13	75099354	critical splice donor site	probably null
Z1176:Pcsk1	UTSW	13	75098042	missense	probably damaging	1.00
Z1177:Pcsk1	UTSW	13	75125864	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAAGTAGCTGTGTTAGTTGACTC -3'
(R):5'- CAGCCAATTATTTCATCAATGCCTC -3'

Sequencing Primer
(F):5'- TGGATCACTTGAAAATCACT -3'
(R):5'- CTGATTTTCTGGCCTCAAAAATCAAC -3'

Posted On

2019-06-26