Incidental Mutation 'R7258:Pcsk1'
ID 564443
Institutional Source Beutler Lab
Gene Symbol Pcsk1
Ensembl Gene ENSMUSG00000021587
Gene Name proprotein convertase subtilisin/kexin type 1
Synonyms PC3, Nec1, Phpp-1, Nec-1, SPC3, prohormone convertase 1/3, PC1
MMRRC Submission 045386-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7258 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 75237945-75282980 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75241305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 95 (R95H)
Ref Sequence ENSEMBL: ENSMUSP00000022075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022075]
AlphaFold P63239
PDB Structure Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000022075
AA Change: R95H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: R95H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 6.4e-26 PFAM
Pfam:Peptidase_S8 158 442 2.2e-49 PFAM
Pfam:P_proprotein 504 591 6.1e-30 PFAM
low complexity region 679 694 N/A INTRINSIC
Pfam:Proho_convert 713 751 4.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik A C 8: 88,312,805 (GRCm39) S197R probably damaging Het
Abcc12 T C 8: 87,287,486 (GRCm39) R120G possibly damaging Het
Abhd14b A G 9: 106,327,418 (GRCm39) I67V probably benign Het
Alpk1 A T 3: 127,518,115 (GRCm39) V62E probably damaging Het
Ankar A G 1: 72,690,886 (GRCm39) V1196A probably benign Het
Ccr5 A T 9: 123,925,311 (GRCm39) K305* probably null Het
Cdc42bpb T C 12: 111,292,518 (GRCm39) H339R probably damaging Het
Cdhr18 A T 14: 13,899,648 (GRCm38) F91L Het
Cep290 T G 10: 100,334,970 (GRCm39) M330R probably benign Het
Cyfip2 T C 11: 46,115,004 (GRCm39) Y901C probably benign Het
Ddx54 T G 5: 120,758,812 (GRCm39) Y352D probably damaging Het
Defa35 A T 8: 21,555,245 (GRCm39) H55L possibly damaging Het
Dnmt3b T A 2: 153,525,519 (GRCm39) probably null Het
Enpep A C 3: 129,125,724 (GRCm39) L136R probably benign Het
Epb41l2 G A 10: 25,360,185 (GRCm39) A516T probably damaging Het
Frmd4a A T 2: 4,305,764 (GRCm39) Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 (GRCm39) D271E possibly damaging Het
Gbp5 T A 3: 142,212,542 (GRCm39) L410H probably damaging Het
Gipc2 T C 3: 151,871,352 (GRCm39) E58G probably damaging Het
Gm6309 A T 5: 146,105,106 (GRCm39) V269E probably benign Het
Grm5 A T 7: 87,723,914 (GRCm39) T735S probably damaging Het
H6pd T C 4: 150,080,819 (GRCm39) M9V probably benign Het
Hmcn1 A G 1: 150,591,574 (GRCm39) I1875T probably benign Het
Hrc T A 7: 44,985,720 (GRCm39) D290E possibly damaging Het
Iftap T C 2: 101,440,937 (GRCm39) D22G probably null Het
Ippk C A 13: 49,587,338 (GRCm39) Q136K probably benign Het
Kcnv1 T C 15: 44,972,711 (GRCm39) T391A probably damaging Het
Kdm5b A C 1: 134,548,759 (GRCm39) E1088A probably damaging Het
L1td1 C T 4: 98,625,101 (GRCm39) A432V probably benign Het
Ly86 A G 13: 37,529,473 (GRCm39) D20G probably benign Het
Myo1g A G 11: 6,459,416 (GRCm39) I818T possibly damaging Het
Nms A G 1: 38,986,051 (GRCm39) T121A probably benign Het
Or1e31 T G 11: 73,690,206 (GRCm39) I126L probably damaging Het
Or1j4 T A 2: 36,740,352 (GRCm39) I98K probably damaging Het
Or51af1 G C 7: 103,141,796 (GRCm39) C96W probably damaging Het
Or6b3 A T 1: 92,438,898 (GRCm39) I284N possibly damaging Het
Or6c69 T A 10: 129,748,156 (GRCm39) probably benign Het
Or8k37 T A 2: 86,469,345 (GRCm39) K236* probably null Het
Pcdhb9 T C 18: 37,535,167 (GRCm39) L387P probably damaging Het
Pde11a T C 2: 75,970,250 (GRCm39) D502G possibly damaging Het
Plekhg2 T C 7: 28,064,203 (GRCm39) D446G probably benign Het
Ptch1 T C 13: 63,721,108 (GRCm39) K54E not run Het
Rasal2 A T 1: 156,985,270 (GRCm39) L826M probably damaging Het
Rnf213 A G 11: 119,343,401 (GRCm39) I3589V Het
Sin3b T C 8: 73,476,836 (GRCm39) C757R probably benign Het
Slc41a1 T A 1: 131,769,780 (GRCm39) V300D probably benign Het
Snorc A C 1: 87,402,789 (GRCm39) I40L probably benign Het
Snrpa1 T C 7: 65,719,891 (GRCm39) F162L probably damaging Het
Sox30 C A 11: 45,871,379 (GRCm39) A78E unknown Het
Ssc4d G T 5: 135,991,941 (GRCm39) A401E probably damaging Het
Steap3 A G 1: 120,171,716 (GRCm39) F130L possibly damaging Het
Stx5a A G 19: 8,732,271 (GRCm39) probably null Het
Tgfbr2 A T 9: 115,958,898 (GRCm39) I172N probably damaging Het
Tgm4 A G 9: 122,891,556 (GRCm39) D557G probably benign Het
Tmprss11c A G 5: 86,419,272 (GRCm39) S96P probably damaging Het
Trpa1 T G 1: 14,973,473 (GRCm39) T282P probably damaging Het
Uba5 A T 9: 103,940,132 (GRCm39) V5E unknown Het
Ugt2b36 A T 5: 87,228,762 (GRCm39) L427H probably damaging Het
Utp14b T A 1: 78,642,691 (GRCm39) H196Q probably benign Het
Vmn2r44 T A 7: 8,380,848 (GRCm39) L348F probably damaging Het
Vmn2r93 T G 17: 18,525,403 (GRCm39) L354V probably benign Het
Wwc2 T A 8: 48,296,034 (GRCm39) N1079Y unknown Het
Zfp653 T C 9: 21,977,116 (GRCm39) D145G probably benign Het
Zfp777 T C 6: 48,002,731 (GRCm39) E453G probably damaging Het
Zfp936 T A 7: 42,839,803 (GRCm39) H423Q probably damaging Het
Zfyve9 A T 4: 108,514,151 (GRCm39) Y496N possibly damaging Het
Other mutations in Pcsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pcsk1 APN 13 75,280,206 (GRCm39) missense probably benign
IGL01554:Pcsk1 APN 13 75,280,426 (GRCm39) missense probably benign
IGL01960:Pcsk1 APN 13 75,241,286 (GRCm39) missense possibly damaging 0.82
IGL02026:Pcsk1 APN 13 75,260,772 (GRCm39) missense probably benign 0.16
IGL02047:Pcsk1 APN 13 75,246,108 (GRCm39) missense probably benign 0.33
IGL02264:Pcsk1 APN 13 75,254,078 (GRCm39) missense probably damaging 1.00
IGL02441:Pcsk1 APN 13 75,280,282 (GRCm39) missense probably benign 0.16
IGL02795:Pcsk1 APN 13 75,260,739 (GRCm39) missense probably damaging 1.00
IGL02829:Pcsk1 APN 13 75,274,955 (GRCm39) missense probably damaging 1.00
IGL03116:Pcsk1 APN 13 75,280,335 (GRCm39) missense probably damaging 0.99
IGL03156:Pcsk1 APN 13 75,280,070 (GRCm39) missense probably benign
clipper UTSW 13 75,278,189 (GRCm39) missense probably damaging 1.00
spareribs UTSW 13 75,263,374 (GRCm39) missense possibly damaging 0.88
swivel UTSW 13 75,274,103 (GRCm39) missense probably damaging 1.00
Tweeze UTSW 13 75,274,958 (GRCm39) missense probably benign 0.00
PIT4453001:Pcsk1 UTSW 13 75,260,769 (GRCm39) missense probably damaging 1.00
R0771:Pcsk1 UTSW 13 75,280,281 (GRCm39) missense probably benign 0.31
R0894:Pcsk1 UTSW 13 75,246,096 (GRCm39) missense probably damaging 1.00
R1014:Pcsk1 UTSW 13 75,280,353 (GRCm39) missense probably damaging 1.00
R1035:Pcsk1 UTSW 13 75,280,238 (GRCm39) missense probably benign
R1199:Pcsk1 UTSW 13 75,244,532 (GRCm39) splice site probably benign
R1517:Pcsk1 UTSW 13 75,246,166 (GRCm39) nonsense probably null
R1625:Pcsk1 UTSW 13 75,274,971 (GRCm39) missense probably benign 0.11
R1691:Pcsk1 UTSW 13 75,280,344 (GRCm39) missense possibly damaging 0.65
R1717:Pcsk1 UTSW 13 75,258,947 (GRCm39) missense probably damaging 0.99
R2168:Pcsk1 UTSW 13 75,260,653 (GRCm39) intron probably benign
R2252:Pcsk1 UTSW 13 75,274,845 (GRCm39) missense probably benign 0.00
R2400:Pcsk1 UTSW 13 75,238,245 (GRCm39) missense probably benign 0.00
R4110:Pcsk1 UTSW 13 75,244,488 (GRCm39) missense probably damaging 0.99
R4358:Pcsk1 UTSW 13 75,260,838 (GRCm39) missense possibly damaging 0.58
R4359:Pcsk1 UTSW 13 75,260,838 (GRCm39) missense possibly damaging 0.58
R4657:Pcsk1 UTSW 13 75,280,354 (GRCm39) missense probably damaging 1.00
R5195:Pcsk1 UTSW 13 75,274,974 (GRCm39) missense probably damaging 1.00
R5669:Pcsk1 UTSW 13 75,278,221 (GRCm39) missense probably benign 0.01
R5671:Pcsk1 UTSW 13 75,246,026 (GRCm39) missense possibly damaging 0.63
R5745:Pcsk1 UTSW 13 75,280,079 (GRCm39) missense probably benign 0.03
R6107:Pcsk1 UTSW 13 75,275,967 (GRCm39) missense probably benign 0.09
R6200:Pcsk1 UTSW 13 75,263,374 (GRCm39) missense possibly damaging 0.88
R6326:Pcsk1 UTSW 13 75,280,298 (GRCm39) missense possibly damaging 0.89
R6537:Pcsk1 UTSW 13 75,280,358 (GRCm39) missense probably damaging 1.00
R6541:Pcsk1 UTSW 13 75,274,103 (GRCm39) missense probably damaging 1.00
R6567:Pcsk1 UTSW 13 75,278,189 (GRCm39) missense probably damaging 1.00
R6723:Pcsk1 UTSW 13 75,241,188 (GRCm39) splice site probably null
R7357:Pcsk1 UTSW 13 75,274,079 (GRCm39) missense probably damaging 0.96
R7487:Pcsk1 UTSW 13 75,259,002 (GRCm39) missense probably benign 0.01
R7519:Pcsk1 UTSW 13 75,258,984 (GRCm39) missense probably damaging 0.99
R7647:Pcsk1 UTSW 13 75,280,329 (GRCm39) missense possibly damaging 0.73
R7787:Pcsk1 UTSW 13 75,280,277 (GRCm39) missense possibly damaging 0.88
R7944:Pcsk1 UTSW 13 75,280,211 (GRCm39) missense probably benign
R7945:Pcsk1 UTSW 13 75,280,211 (GRCm39) missense probably benign
R7961:Pcsk1 UTSW 13 75,274,958 (GRCm39) missense probably benign 0.00
R8009:Pcsk1 UTSW 13 75,274,958 (GRCm39) missense probably benign 0.00
R8022:Pcsk1 UTSW 13 75,247,412 (GRCm39) missense possibly damaging 0.77
R8171:Pcsk1 UTSW 13 75,238,210 (GRCm39) nonsense probably null
R8489:Pcsk1 UTSW 13 75,274,121 (GRCm39) missense probably damaging 1.00
R9310:Pcsk1 UTSW 13 75,238,191 (GRCm39) missense probably benign
R9404:Pcsk1 UTSW 13 75,280,342 (GRCm39) missense probably benign 0.11
R9544:Pcsk1 UTSW 13 75,259,039 (GRCm39) missense probably damaging 0.99
R9588:Pcsk1 UTSW 13 75,259,039 (GRCm39) missense probably damaging 0.99
R9706:Pcsk1 UTSW 13 75,247,473 (GRCm39) critical splice donor site probably null
Z1176:Pcsk1 UTSW 13 75,246,161 (GRCm39) missense probably damaging 1.00
Z1177:Pcsk1 UTSW 13 75,273,983 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGTAGCTGTGTTAGTTGACTC -3'
(R):5'- CAGCCAATTATTTCATCAATGCCTC -3'

Sequencing Primer
(F):5'- TGGATCACTTGAAAATCACT -3'
(R):5'- CTGATTTTCTGGCCTCAAAAATCAAC -3'
Posted On 2019-06-26