Incidental Mutation 'R7258:Gm281'
ID564444
Institutional Source Beutler Lab
Gene Symbol Gm281
Ensembl Gene ENSMUSG00000084902
Gene Namepredicted gene 281
SynonymsLOC238939
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7258 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location13814618-13914478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13899648 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 91 (F91L)
Ref Sequence ENSEMBL: ENSMUSP00000121887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144914]
Predicted Effect
SMART Domains Protein: ENSMUSP00000121887
Gene: ENSMUSG00000084902
AA Change: F91L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CA 32 127 3.45e-2 SMART
CA 156 230 7.87e-9 SMART
CA 274 352 1.36e-3 SMART
CA 376 470 6.99e-3 SMART
CA 492 563 8.69e-11 SMART
CA 589 683 2.09e-1 SMART
transmembrane domain 705 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A C 1: 87,475,067 I40L probably benign Het
4933402J07Rik A C 8: 87,586,177 S197R probably damaging Het
Abcc12 T C 8: 86,560,857 R120G possibly damaging Het
Abhd14b A G 9: 106,450,219 I67V probably benign Het
Alpk1 A T 3: 127,724,466 V62E probably damaging Het
Ankar A G 1: 72,651,727 V1196A probably benign Het
B230118H07Rik T C 2: 101,610,592 D22G probably null Het
Ccr5 A T 9: 124,125,274 K305* probably null Het
Cdc42bpb T C 12: 111,326,084 H339R probably damaging Het
Cep290 T G 10: 100,499,108 M330R probably benign Het
Cyfip2 T C 11: 46,224,177 Y901C probably benign Het
Ddx54 T G 5: 120,620,747 Y352D probably damaging Het
Defa35 A T 8: 21,065,229 H55L possibly damaging Het
Dnmt3b T A 2: 153,683,599 probably null Het
Enpep A C 3: 129,332,075 L136R probably benign Het
Epb41l2 G A 10: 25,484,287 A516T probably damaging Het
Frmd4a A T 2: 4,300,953 Q13L probably benign Het
Frmpd1 C A 4: 45,269,974 D271E possibly damaging Het
Gbp5 T A 3: 142,506,781 L410H probably damaging Het
Gipc2 T C 3: 152,165,715 E58G probably damaging Het
Gm6309 A T 5: 146,168,296 V269E probably benign Het
Grm5 A T 7: 88,074,706 T735S probably damaging Het
H6pd T C 4: 149,996,362 M9V probably benign Het
Hmcn1 A G 1: 150,715,823 I1875T probably benign Het
Hrc T A 7: 45,336,296 D290E possibly damaging Het
Ippk C A 13: 49,433,862 Q136K probably benign Het
Kcnv1 T C 15: 45,109,315 T391A probably damaging Het
Kdm5b A C 1: 134,621,021 E1088A probably damaging Het
L1td1 C T 4: 98,736,864 A432V probably benign Het
Ly86 A G 13: 37,345,497 D20G probably benign Het
Myo1g A G 11: 6,509,416 I818T possibly damaging Het
Nms A G 1: 38,946,970 T121A probably benign Het
Olfr1084 T A 2: 86,639,001 K236* probably null Het
Olfr1414 A T 1: 92,511,176 I284N possibly damaging Het
Olfr350 T A 2: 36,850,340 I98K probably damaging Het
Olfr391-ps T G 11: 73,799,380 I126L probably damaging Het
Olfr609 G C 7: 103,492,589 C96W probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Pcdhb9 T C 18: 37,402,114 L387P probably damaging Het
Pcsk1 G A 13: 75,093,186 R95H probably damaging Het
Pde11a T C 2: 76,139,906 D502G possibly damaging Het
Plekhg2 T C 7: 28,364,778 D446G probably benign Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rasal2 A T 1: 157,157,700 L826M probably damaging Het
Rnf213 A G 11: 119,452,575 I3589V Het
Sin3b T C 8: 72,750,208 C757R probably benign Het
Slc41a1 T A 1: 131,842,042 V300D probably benign Het
Snrpa1 T C 7: 66,070,143 F162L probably damaging Het
Sox30 C A 11: 45,980,552 A78E unknown Het
Ssc4d G T 5: 135,963,087 A401E probably damaging Het
Steap3 A G 1: 120,243,986 F130L possibly damaging Het
Stx5a A G 19: 8,754,907 probably null Het
Tgfbr2 A T 9: 116,129,830 I172N probably damaging Het
Tgm4 A G 9: 123,062,491 D557G probably benign Het
Tmprss11c A G 5: 86,271,413 S96P probably damaging Het
Trpa1 T G 1: 14,903,249 T282P probably damaging Het
Uba5 A T 9: 104,062,933 V5E unknown Het
Ugt2b36 A T 5: 87,080,903 L427H probably damaging Het
Utp14b T A 1: 78,664,974 H196Q probably benign Het
Vmn2r44 T A 7: 8,377,849 L348F probably damaging Het
Vmn2r93 T G 17: 18,305,141 L354V probably benign Het
Wwc2 T A 8: 47,842,999 N1079Y unknown Het
Zfp653 T C 9: 22,065,820 D145G probably benign Het
Zfp777 T C 6: 48,025,797 E453G probably damaging Het
Zfp936 T A 7: 43,190,379 H423Q probably damaging Het
Zfyve9 A T 4: 108,656,954 Y496N possibly damaging Het
Other mutations in Gm281
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Gm281 UTSW 14 13899571 missense probably damaging 0.99
R0842:Gm281 UTSW 14 13856686 missense probably benign 0.16
R1252:Gm281 UTSW 14 13862444 missense probably benign 0.00
R1275:Gm281 UTSW 14 13896949 missense probably damaging 1.00
R1631:Gm281 UTSW 14 13829796 missense probably damaging 0.99
R1831:Gm281 UTSW 14 13899619 missense probably damaging 1.00
R1885:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1886:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1887:Gm281 UTSW 14 13828607 missense probably damaging 1.00
R1903:Gm281 UTSW 14 13829657 missense possibly damaging 0.94
R1940:Gm281 UTSW 14 13828582 missense probably null 0.95
R2324:Gm281 UTSW 14 13868077 missense probably damaging 1.00
R3923:Gm281 UTSW 14 13865990 nonsense probably null
R4193:Gm281 UTSW 14 13914416 missense probably benign 0.02
R4195:Gm281 UTSW 14 13829772 missense probably benign 0.05
R4370:Gm281 UTSW 14 13862375 missense probably benign 0.03
R4675:Gm281 UTSW 14 13856724 missense probably benign 0.32
R4734:Gm281 UTSW 14 13845292 missense probably benign 0.13
R5387:Gm281 UTSW 14 13914438 start codon destroyed probably null 0.82
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6037:Gm281 UTSW 14 13864282 missense probably damaging 1.00
R6177:Gm281 UTSW 14 13868002 missense probably benign 0.08
R7051:Gm281 UTSW 14 13828486 missense
R7205:Gm281 UTSW 14 13866032 missense
R7833:Gm281 UTSW 14 13896968 splice site probably null
R8309:Gm281 UTSW 14 13814954 nonsense probably null
Z1177:Gm281 UTSW 14 13823754 missense
Z1177:Gm281 UTSW 14 13845421 missense
Predicted Primers PCR Primer
(F):5'- CTTGCTTTCCCTCAAAACAGAC -3'
(R):5'- CATTTTGCTGTGTAGGCCAC -3'

Sequencing Primer
(F):5'- AACAGACCGTTGGTACCTTG -3'
(R):5'- GTCAACAATTTGGTCCTCC -3'
Posted On2019-06-26