Incidental Mutation 'R7259:Kif1a'
ID564451
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Namekinesin family member 1A
SynonymsLOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1
MMRRC Submission
Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R7259 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93015464-93101951 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 93073810 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 266 (K266*)
Ref Sequence ENSEMBL: ENSMUSP00000128432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000186861] [ENSMUST00000190723]
Predicted Effect probably null
Transcript: ENSMUST00000086819
AA Change: K266*
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: K266*

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112958
AA Change: K266*
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: K266*

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171556
AA Change: K266*
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: K266*

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171796
AA Change: K266*
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: K266*

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186861
SMART Domains Protein: ENSMUSP00000141194
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 109 9.7e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190723
AA Change: K266*
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: K266*

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,570,252 Y258C probably benign Het
Aebp2 A G 6: 140,633,768 S244G probably benign Het
Agl A T 3: 116,784,581 Y495N probably damaging Het
Arhgap33 A G 7: 30,532,200 V120A probably damaging Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atp2a2 A G 5: 122,466,069 Y434H probably benign Het
Atrnl1 C T 19: 57,935,606 R1268* probably null Het
AW554918 A G 18: 25,289,849 probably null Het
Canx A G 11: 50,301,816 W324R probably damaging Het
Ccdc130 T C 8: 84,260,317 S184G probably damaging Het
Col9a1 A G 1: 24,185,343 E202G unknown Het
Crh C A 3: 19,694,254 A75S possibly damaging Het
Ctnnal1 T A 4: 56,817,299 probably null Het
Dmrta2 T A 4: 109,981,907 S284T possibly damaging Het
Dock1 T C 7: 134,782,748 V680A probably damaging Het
Duox2 G A 2: 122,295,176 R317C probably damaging Het
Elmod2 A G 8: 83,321,509 L108P probably damaging Het
Exoc6b A G 6: 84,848,810 S540P probably benign Het
Fsip2 C T 2: 82,982,130 A2931V possibly damaging Het
Gipc2 A T 3: 152,128,056 I196K probably damaging Het
Gli2 A G 1: 118,836,534 S1296P probably benign Het
Gm21103 T A 14: 6,301,894 Q173L probably damaging Het
Gpatch1 A T 7: 35,287,121 probably null Het
Grm8 G A 6: 27,760,176 T385I probably null Het
Gtf2f1 C A 17: 57,004,562 D283Y probably damaging Het
Hcar1 T A 5: 123,879,212 T139S possibly damaging Het
Hcrtr1 T A 4: 130,135,818 T157S possibly damaging Het
Htra2 T G 6: 83,051,539 Q436P possibly damaging Het
Igkv1-133 A G 6: 67,725,538 D80G probably benign Het
Il21 C A 3: 37,227,654 probably null Het
Inpp5f T A 7: 128,669,957 C359S probably benign Het
Itgb6 A T 2: 60,650,011 I327N probably damaging Het
Itgbl1 A T 14: 123,843,904 T232S probably damaging Het
Mcm10 C A 2: 5,006,517 E214D probably benign Het
Mefv T A 16: 3,713,053 I522F probably damaging Het
Naaladl2 T A 3: 24,058,176 I581F possibly damaging Het
Naip6 A T 13: 100,304,355 Y306N probably damaging Het
Olfr1224-ps1 A C 2: 89,156,510 F222V probably benign Het
Olfr172 T C 16: 58,760,505 T224A possibly damaging Het
Olfr621-ps1 A T 7: 103,629,759 M67K probably damaging Het
Olfr780 T A 10: 129,321,794 M57K probably benign Het
Opn1sw T A 6: 29,378,912 H247L probably benign Het
Pbxip1 C A 3: 89,445,633 F195L probably benign Het
Pcdh12 A T 18: 38,281,624 F816Y probably benign Het
Pi4k2b C A 5: 52,753,245 N290K probably damaging Het
Pias2 T C 18: 77,152,720 S598P possibly damaging Het
Ppfia4 A G 1: 134,313,100 V835A probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rnf213 A G 11: 119,452,575 I3589V Het
Scg2 T C 1: 79,436,985 Y7C probably benign Het
Sec16a A G 2: 26,441,592 V137A probably benign Het
Setdb1 G A 3: 95,339,913 T525I probably benign Het
Sgcg A T 14: 61,225,217 I227N probably benign Het
Slc35e4 A T 11: 3,912,530 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Stk10 A G 11: 32,598,497 N355S probably benign Het
Supt6 A T 11: 78,207,616 D1716E probably damaging Het
Taok3 C T 5: 117,252,543 A523V probably benign Het
Tekt3 A G 11: 63,083,766 T304A possibly damaging Het
Ttc6 G T 12: 57,576,184 R123L probably benign Het
Tyw1 T A 5: 130,267,872 probably null Het
Ulk2 A G 11: 61,782,083 L895P probably damaging Het
Unc13c A T 9: 73,517,363 N1990K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wipf1 A G 2: 73,435,081 S393P probably damaging Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 93054934 missense probably damaging 1.00
IGL01574:Kif1a APN 1 93082340 missense probably damaging 1.00
IGL01637:Kif1a APN 1 93039853 missense possibly damaging 0.95
IGL01895:Kif1a APN 1 93025733 missense possibly damaging 0.65
IGL02215:Kif1a APN 1 93020549 missense probably benign 0.05
IGL02571:Kif1a APN 1 93020456 critical splice donor site probably null
IGL02734:Kif1a APN 1 93062558 missense probably damaging 1.00
IGL02752:Kif1a APN 1 93039847 missense possibly damaging 0.92
IGL02990:Kif1a APN 1 93039263 missense probably damaging 1.00
IGL03298:Kif1a APN 1 93066181 missense probably damaging 1.00
IGL03309:Kif1a APN 1 93058857 nonsense probably null
IGL03354:Kif1a APN 1 93060235 missense probably damaging 1.00
asbestos UTSW 1 93022505 missense probably damaging 1.00
chrysolite UTSW 1 93074948 splice site probably benign
osmium UTSW 1 93058810 splice site probably benign
1mM(1):Kif1a UTSW 1 93077068 missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93082406 missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 93046729 missense probably damaging 1.00
R0025:Kif1a UTSW 1 93042358 missense probably damaging 1.00
R0115:Kif1a UTSW 1 93046778 splice site probably benign
R0243:Kif1a UTSW 1 93042093 missense probably damaging 1.00
R0270:Kif1a UTSW 1 93054442 splice site probably benign
R0335:Kif1a UTSW 1 93052566 splice site probably benign
R0380:Kif1a UTSW 1 93056031 critical splice acceptor site probably null
R0472:Kif1a UTSW 1 93018997 missense probably damaging 0.99
R0501:Kif1a UTSW 1 93056245 missense probably damaging 1.00
R0538:Kif1a UTSW 1 93043638 missense probably damaging 0.99
R0628:Kif1a UTSW 1 93019883 missense probably damaging 1.00
R0848:Kif1a UTSW 1 93019898 missense probably damaging 1.00
R1110:Kif1a UTSW 1 93023453 splice site probably benign
R1132:Kif1a UTSW 1 93056021 missense probably damaging 0.99
R1387:Kif1a UTSW 1 93055950 splice site probably benign
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93074948 splice site probably benign
R1569:Kif1a UTSW 1 93058810 splice site probably benign
R1802:Kif1a UTSW 1 93066149 missense probably damaging 1.00
R1917:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1919:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1999:Kif1a UTSW 1 93060795 missense probably damaging 0.98
R2000:Kif1a UTSW 1 93054329 missense probably damaging 0.99
R2276:Kif1a UTSW 1 93068477 splice site probably benign
R2307:Kif1a UTSW 1 93078769 missense probably damaging 1.00
R2919:Kif1a UTSW 1 93046742 missense probably damaging 1.00
R3440:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3441:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93077043 missense probably null 1.00
R3957:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R4010:Kif1a UTSW 1 93022409 missense probably benign 0.42
R4013:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4017:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4115:Kif1a UTSW 1 93052538 missense probably damaging 1.00
R4386:Kif1a UTSW 1 93068550 missense probably damaging 1.00
R4538:Kif1a UTSW 1 93077047 missense probably damaging 1.00
R4608:Kif1a UTSW 1 93024646 missense possibly damaging 0.81
R4625:Kif1a UTSW 1 93042659 missense probably benign 0.00
R4701:Kif1a UTSW 1 93078835 missense probably damaging 0.99
R4794:Kif1a UTSW 1 93025727 missense probably damaging 1.00
R4830:Kif1a UTSW 1 93021209 splice site probably null
R4903:Kif1a UTSW 1 93021734 missense probably damaging 1.00
R4915:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4918:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4991:Kif1a UTSW 1 93078808 missense probably benign 0.00
R5028:Kif1a UTSW 1 93054327 missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93076154 unclassified probably null
R5073:Kif1a UTSW 1 93022505 missense probably damaging 1.00
R5103:Kif1a UTSW 1 93046696 missense probably damaging 1.00
R5314:Kif1a UTSW 1 93018498 missense probably damaging 1.00
R5481:Kif1a UTSW 1 93060244 missense probably benign 0.01
R5510:Kif1a UTSW 1 93041692 missense possibly damaging 0.93
R5610:Kif1a UTSW 1 93025728 missense probably damaging 1.00
R5643:Kif1a UTSW 1 93055767 missense probably damaging 0.98
R5808:Kif1a UTSW 1 93042698 missense probably damaging 0.99
R6027:Kif1a UTSW 1 93025643 missense probably benign 0.33
R6056:Kif1a UTSW 1 93024648 missense probably damaging 1.00
R6077:Kif1a UTSW 1 93054896 missense possibly damaging 0.54
R6120:Kif1a UTSW 1 93024574 splice site probably null
R6126:Kif1a UTSW 1 93019899 missense probably damaging 1.00
R6130:Kif1a UTSW 1 93036901 missense probably damaging 1.00
R6255:Kif1a UTSW 1 93019983 missense probably damaging 1.00
R6301:Kif1a UTSW 1 93054941 nonsense probably null
R6326:Kif1a UTSW 1 93076326 missense probably damaging 1.00
R6594:Kif1a UTSW 1 93021313 missense probably benign 0.00
R6653:Kif1a UTSW 1 93077698 missense probably damaging 1.00
R6791:Kif1a UTSW 1 93066137 missense probably damaging 1.00
R6853:Kif1a UTSW 1 93039802 missense possibly damaging 0.47
R7022:Kif1a UTSW 1 93066098 missense probably benign 0.31
R7059:Kif1a UTSW 1 93046829 intron probably benign
R7103:Kif1a UTSW 1 93077785 missense probably damaging 1.00
R7248:Kif1a UTSW 1 93041583 missense probably benign 0.35
R7424:Kif1a UTSW 1 93054317 missense possibly damaging 0.89
R7681:Kif1a UTSW 1 93054944 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCTACTGAACGCCAAAGAAC -3'
(R):5'- AACTGGGGCCATCAAAGATG -3'

Sequencing Primer
(F):5'- GCCAAAGAACGCCCATGTAC -3'
(R):5'- GTCTATAGCTCTTCAAGTAGCTAACG -3'
Posted On2019-06-26