Mutagenetix > Incidental Mutations

Incidental Mutation 'R7259:Il21'

564463

Institutional Source

Beutler Lab

Gene Symbol

Il21

Ensembl Gene

ENSMUSG00000027718

Gene Name

interleukin 21

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7259 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

37222759-37232636 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to A at 37227654 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]

AlphaFold

Q9ES17

Predicted Effect

probably null
Transcript: ENSMUST00000029273

SMART Domains

Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718

Domain	Start	End	E-Value	Type
Pfam:IL15	4	142	7.2e-11	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161015

SMART Domains

Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	26	38	N/A	INTRINSIC
PDB:3TGX\|P	39	140	8e-36	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adarb2	A	G	13: 8,570,252	Y258C	probably benign	Het
Aebp2	A	G	6: 140,633,768	S244G	probably benign	Het
Agl	A	T	3: 116,784,581	Y495N	probably damaging	Het
Arhgap33	A	G	7: 30,532,200	V120A	probably damaging	Het
Asb14	C	T	14: 26,903,455	H256Y	probably benign	Het
Atp2a2	A	G	5: 122,466,069	Y434H	probably benign	Het
Atrnl1	C	T	19: 57,935,606	R1268*	probably null	Het
AW554918	A	G	18: 25,289,849		probably null	Het
Canx	A	G	11: 50,301,816	W324R	probably damaging	Het
Ccdc130	T	C	8: 84,260,317	S184G	probably damaging	Het
Col9a1	A	G	1: 24,185,343	E202G	unknown	Het
Crh	C	A	3: 19,694,254	A75S	possibly damaging	Het
Ctnnal1	T	A	4: 56,817,299		probably null	Het
Dmrta2	T	A	4: 109,981,907	S284T	possibly damaging	Het
Dock1	T	C	7: 134,782,748	V680A	probably damaging	Het
Duox2	G	A	2: 122,295,176	R317C	probably damaging	Het
Elmod2	A	G	8: 83,321,509	L108P	probably damaging	Het
Exoc6b	A	G	6: 84,848,810	S540P	probably benign	Het
Fsip2	C	T	2: 82,982,130	A2931V	possibly damaging	Het
Gipc2	A	T	3: 152,128,056	I196K	probably damaging	Het
Gli2	A	G	1: 118,836,534	S1296P	probably benign	Het
Gm21103	T	A	14: 6,301,894	Q173L	probably damaging	Het
Gpatch1	A	T	7: 35,287,121		probably null	Het
Grm8	G	A	6: 27,760,176	T385I	probably null	Het
Gtf2f1	C	A	17: 57,004,562	D283Y	probably damaging	Het
Hcar1	T	A	5: 123,879,212	T139S	possibly damaging	Het
Hcrtr1	T	A	4: 130,135,818	T157S	possibly damaging	Het
Htra2	T	G	6: 83,051,539	Q436P	possibly damaging	Het
Igkv1-133	A	G	6: 67,725,538	D80G	probably benign	Het
Inpp5f	T	A	7: 128,669,957	C359S	probably benign	Het
Itgb6	A	T	2: 60,650,011	I327N	probably damaging	Het
Itgbl1	A	T	14: 123,843,904	T232S	probably damaging	Het
Kif1a	T	A	1: 93,073,810	K266*	probably null	Het
Mcm10	C	A	2: 5,006,517	E214D	probably benign	Het
Mefv	T	A	16: 3,713,053	I522F	probably damaging	Het
Naaladl2	T	A	3: 24,058,176	I581F	possibly damaging	Het
Naip6	A	T	13: 100,304,355	Y306N	probably damaging	Het
Olfr1224-ps1	A	C	2: 89,156,510	F222V	probably benign	Het
Olfr172	T	C	16: 58,760,505	T224A	possibly damaging	Het
Olfr621-ps1	A	T	7: 103,629,759	M67K	probably damaging	Het
Olfr780	T	A	10: 129,321,794	M57K	probably benign	Het
Opn1sw	T	A	6: 29,378,912	H247L	probably benign	Het
Pbxip1	C	A	3: 89,445,633	F195L	probably benign	Het
Pcdh12	A	T	18: 38,281,624	F816Y	probably benign	Het
Pi4k2b	C	A	5: 52,753,245	N290K	probably damaging	Het
Pias2	T	C	18: 77,152,720	S598P	possibly damaging	Het
Ppfia4	A	G	1: 134,313,100	V835A	probably damaging	Het
Ptch1	T	C	13: 63,573,294	K54E	not run	Het
Rnf213	A	G	11: 119,452,575	I3589V		Het
Scg2	T	C	1: 79,436,985	Y7C	probably benign	Het
Sec16a	A	G	2: 26,441,592	V137A	probably benign	Het
Setdb1	G	A	3: 95,339,913	T525I	probably benign	Het
Sgcg	A	T	14: 61,225,217	I227N	probably benign	Het
Slc35e4	A	T	11: 3,912,530		probably null	Het
Smarca2	C	T	19: 26,654,464	Q560*	probably null	Het
Stk10	A	G	11: 32,598,497	N355S	probably benign	Het
Supt6	A	T	11: 78,207,616	D1716E	probably damaging	Het
Taok3	C	T	5: 117,252,543	A523V	probably benign	Het
Tekt3	A	G	11: 63,083,766	T304A	possibly damaging	Het
Ttc6	G	T	12: 57,576,184	R123L	probably benign	Het
Tyw1	T	A	5: 130,267,872		probably null	Het
Ulk2	A	G	11: 61,782,083	L895P	probably damaging	Het
Unc13c	A	T	9: 73,517,363	N1990K	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wipf1	A	G	2: 73,435,081	S393P	probably damaging	Het

Other mutations in Il21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0433:Il21	UTSW	3	37232535	missense	possibly damaging	0.46
R0579:Il21	UTSW	3	37227774	missense	possibly damaging	0.65
R1641:Il21	UTSW	3	37232532	missense	probably benign	0.00
R1741:Il21	UTSW	3	37227662	missense	probably benign	0.00
R1754:Il21	UTSW	3	37225525	missense	possibly damaging	0.93
R1933:Il21	UTSW	3	37232486	missense	probably benign
R4560:Il21	UTSW	3	37225484	nonsense	probably null
R4975:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R4977:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R4979:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R5254:Il21	UTSW	3	37227735	missense	possibly damaging	0.94
R5267:Il21	UTSW	3	37227797	missense	probably benign
R5641:Il21	UTSW	3	37227768	nonsense	probably null
R7058:Il21	UTSW	3	37232480	missense	probably damaging	1.00
R9039:Il21	UTSW	3	37232453	missense	probably benign
R9249:Il21	UTSW	3	37225528	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTTCTAGTAGGGTTTCTAGACAGAC -3'
(R):5'- AATTGTCTCTCCTTTCAGGGGC -3'

Sequencing Primer
(F):5'- TGGAGGTGACACCACTTTTCAAAG -3'
(R):5'- GCACTGTGAGCATGCAGC -3'

Posted On

2019-06-26