Incidental Mutation 'R7259:Agl'
ID564466
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R7259 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116784581 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 495 (Y495N)
Ref Sequence ENSEMBL: ENSMUSP00000143582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect probably damaging
Transcript: ENSMUST00000040603
AA Change: Y495N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: Y495N

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159742
AA Change: Y495N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: Y495N

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159995
SMART Domains Protein: ENSMUSP00000125246
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_central 119 197 8.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160484
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162792
AA Change: Y495N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: Y495N

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,570,252 Y258C probably benign Het
Aebp2 A G 6: 140,633,768 S244G probably benign Het
Arhgap33 A G 7: 30,532,200 V120A probably damaging Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atp2a2 A G 5: 122,466,069 Y434H probably benign Het
Atrnl1 C T 19: 57,935,606 R1268* probably null Het
AW554918 A G 18: 25,289,849 probably null Het
Canx A G 11: 50,301,816 W324R probably damaging Het
Ccdc130 T C 8: 84,260,317 S184G probably damaging Het
Col9a1 A G 1: 24,185,343 E202G unknown Het
Crh C A 3: 19,694,254 A75S possibly damaging Het
Ctnnal1 T A 4: 56,817,299 probably null Het
Dmrta2 T A 4: 109,981,907 S284T possibly damaging Het
Dock1 T C 7: 134,782,748 V680A probably damaging Het
Duox2 G A 2: 122,295,176 R317C probably damaging Het
Elmod2 A G 8: 83,321,509 L108P probably damaging Het
Exoc6b A G 6: 84,848,810 S540P probably benign Het
Fsip2 C T 2: 82,982,130 A2931V possibly damaging Het
Gipc2 A T 3: 152,128,056 I196K probably damaging Het
Gli2 A G 1: 118,836,534 S1296P probably benign Het
Gm21103 T A 14: 6,301,894 Q173L probably damaging Het
Gpatch1 A T 7: 35,287,121 probably null Het
Grm8 G A 6: 27,760,176 T385I probably null Het
Gtf2f1 C A 17: 57,004,562 D283Y probably damaging Het
Hcar1 T A 5: 123,879,212 T139S possibly damaging Het
Hcrtr1 T A 4: 130,135,818 T157S possibly damaging Het
Htra2 T G 6: 83,051,539 Q436P possibly damaging Het
Igkv1-133 A G 6: 67,725,538 D80G probably benign Het
Il21 C A 3: 37,227,654 probably null Het
Inpp5f T A 7: 128,669,957 C359S probably benign Het
Itgb6 A T 2: 60,650,011 I327N probably damaging Het
Itgbl1 A T 14: 123,843,904 T232S probably damaging Het
Kif1a T A 1: 93,073,810 K266* probably null Het
Mcm10 C A 2: 5,006,517 E214D probably benign Het
Mefv T A 16: 3,713,053 I522F probably damaging Het
Naaladl2 T A 3: 24,058,176 I581F possibly damaging Het
Naip6 A T 13: 100,304,355 Y306N probably damaging Het
Olfr1224-ps1 A C 2: 89,156,510 F222V probably benign Het
Olfr172 T C 16: 58,760,505 T224A possibly damaging Het
Olfr621-ps1 A T 7: 103,629,759 M67K probably damaging Het
Olfr780 T A 10: 129,321,794 M57K probably benign Het
Opn1sw T A 6: 29,378,912 H247L probably benign Het
Pbxip1 C A 3: 89,445,633 F195L probably benign Het
Pcdh12 A T 18: 38,281,624 F816Y probably benign Het
Pi4k2b C A 5: 52,753,245 N290K probably damaging Het
Pias2 T C 18: 77,152,720 S598P possibly damaging Het
Ppfia4 A G 1: 134,313,100 V835A probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rnf213 A G 11: 119,452,575 I3589V Het
Scg2 T C 1: 79,436,985 Y7C probably benign Het
Sec16a A G 2: 26,441,592 V137A probably benign Het
Setdb1 G A 3: 95,339,913 T525I probably benign Het
Sgcg A T 14: 61,225,217 I227N probably benign Het
Slc35e4 A T 11: 3,912,530 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Stk10 A G 11: 32,598,497 N355S probably benign Het
Supt6 A T 11: 78,207,616 D1716E probably damaging Het
Taok3 C T 5: 117,252,543 A523V probably benign Het
Tekt3 A G 11: 63,083,766 T304A possibly damaging Het
Ttc6 G T 12: 57,576,184 R123L probably benign Het
Tyw1 T A 5: 130,267,872 probably null Het
Ulk2 A G 11: 61,782,083 L895P probably damaging Het
Unc13c A T 9: 73,517,363 N1990K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wipf1 A G 2: 73,435,081 S393P probably damaging Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
X0065:Agl UTSW 3 116781330 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTACAGGTATCACTGCC -3'
(R):5'- GGCCACTTTACATGTAACTTTAGTCAG -3'

Sequencing Primer
(F):5'- TCACTGCCTTTGTCAATAGAGG -3'
(R):5'- CAGGGGATCAAACACTCTTCTGG -3'
Posted On2019-06-26