Incidental Mutation 'R0581:Cyp2c54'
ID56447
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 038771-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0581 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40037941-40073811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40047555 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 304 (T304S)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
Predicted Effect probably benign
Transcript: ENSMUST00000048959
AA Change: T304S

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: T304S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Meta Mutation Damage Score 0.3098 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.3%
  • 20x: 93.7%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,050,620 T2761A probably benign Het
Apold1 G A 6: 134,983,813 V77I probably benign Het
Atad2 T C 15: 58,126,664 T139A probably benign Het
Cacna1a A T 8: 84,601,936 I1668F possibly damaging Het
Ccer2 T A 7: 28,757,026 probably benign Het
Dpp4 T A 2: 62,356,676 M497L probably benign Het
Evpl T A 11: 116,229,490 I541L probably benign Het
Ggn A G 7: 29,172,304 T370A probably benign Het
Ghr A G 15: 3,388,634 probably benign Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gpr68 G C 12: 100,878,556 P243R probably damaging Het
Gtf3c2 G T 5: 31,159,518 Y720* probably null Het
Il2rb T A 15: 78,481,936 Y387F possibly damaging Het
Kcnu1 T A 8: 25,937,501 V282E probably damaging Het
Krt222 G A 11: 99,236,192 Q201* probably null Het
Lats1 A G 10: 7,702,941 T610A possibly damaging Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Myh7 T C 14: 54,985,496 I751V probably benign Het
Mypn A G 10: 63,162,244 I429T probably benign Het
Nemf A T 12: 69,322,271 D723E probably benign Het
Nlrp4b T C 7: 10,714,530 L220P probably damaging Het
Npr3 T A 15: 11,851,450 D418V probably damaging Het
Nsd3 A G 8: 25,710,691 N1270S probably damaging Het
Olfr123 A G 17: 37,796,102 I219M probably damaging Het
Olfr344 T C 2: 36,568,822 S75P probably damaging Het
Otogl G A 10: 107,789,040 T1579I possibly damaging Het
Pkp2 T A 16: 16,269,783 probably benign Het
Psd3 T C 8: 67,720,946 Y301C probably damaging Het
Psmb4 T C 3: 94,886,168 H134R probably damaging Het
Ralgapb A G 2: 158,492,961 T1043A probably benign Het
Sec14l5 T A 16: 5,178,485 probably null Het
Serpina12 T A 12: 104,031,140 Q374L probably damaging Het
Serpinb10 C T 1: 107,546,962 R362* probably null Het
Sorcs1 T A 19: 50,252,701 I416F possibly damaging Het
Sparcl1 T C 5: 104,093,312 D82G probably damaging Het
Stat6 A T 10: 127,648,116 Q89L probably damaging Het
Tat A G 8: 109,991,638 T52A possibly damaging Het
Yipf7 T A 5: 69,521,063 I128F probably benign Het
Zfp112 T A 7: 24,125,863 C419S probably damaging Het
Zzef1 A G 11: 72,851,900 I769V probably benign Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40072078 missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40047543 missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40072365 critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40070228 missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40047658 splice site probably benign
R0097:Cyp2c54 UTSW 19 40047659 splice site probably benign
R0391:Cyp2c54 UTSW 19 40072169 missense possibly damaging 0.61
R0787:Cyp2c54 UTSW 19 40047635 missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40046185 missense probably damaging 1.00
R1481:Cyp2c54 UTSW 19 40047588 missense probably benign 0.30
R1604:Cyp2c54 UTSW 19 40070343 missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40072423 missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40046255 missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40072171 missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40038259 missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40072141 missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40072474 missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40072414 missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40073762 missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40047561 missense probably benign
R6754:Cyp2c54 UTSW 19 40071560 missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40070259 missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40046192 missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40046182 missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40047509 missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40070253 nonsense probably null
R7535:Cyp2c54 UTSW 19 40070272 missense probably benign
R7838:Cyp2c54 UTSW 19 40070244 missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40073732 frame shift probably null
R8275:Cyp2c54 UTSW 19 40038305 missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40072387 missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40073681 missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40070264 missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40071546 missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40038413 missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40047586 missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40073783 missense probably benign 0.00
Z1176:Cyp2c54 UTSW 19 40046215 missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40073757 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGTCACCCTCCTCATTACAGACAGTG -3'
(R):5'- ACACACCTGGGCAGATAATCTTTGG -3'

Sequencing Primer
(F):5'- TCCTCATTACAGACAGTGAAACAG -3'
(R):5'- GGAAGATGACAATCATCCTTTGAAA -3'
Posted On2013-07-11