Incidental Mutation 'R7259:Sgcg'
ID564502
Institutional Source Beutler Lab
Gene Symbol Sgcg
Ensembl Gene ENSMUSG00000035296
Gene Namesarcoglycan, gamma (dystrophin-associated glycoprotein)
Synonymsgamma-SG, 5430420E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R7259 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location61219115-61258490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61225217 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 227 (I227N)
Ref Sequence ENSEMBL: ENSMUSP00000077106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077954] [ENSMUST00000089394] [ENSMUST00000121148]
Predicted Effect probably benign
Transcript: ENSMUST00000077954
AA Change: I227N

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077106
Gene: ENSMUSG00000035296
AA Change: I227N

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 25 280 1.2e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121148
AA Change: I227N

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112576
Gene: ENSMUSG00000035296
AA Change: I227N

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 23 284 1.1e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gamma-sarcoglycan, one of several sarcolemmal transmembrane glycoproteins that interact with dystrophin. The dystrophin-glycoprotein complex (DGC) spans the sarcolemma and is comprised of dystrophin, syntrophin, alpha- and beta-dystroglycans and sarcoglycans. The DGC provides a structural link between the subsarcolemmal cytoskeleton and the extracellular matrix of muscle cells. Defects in the encoded protein can lead to early onset autosomal recessive muscular dystrophy, in particular limb-girdle muscular dystrophy, type 2C (LGMD2C). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in muscles and heart similar to muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,570,252 Y258C probably benign Het
Aebp2 A G 6: 140,633,768 S244G probably benign Het
Agl A T 3: 116,784,581 Y495N probably damaging Het
Arhgap33 A G 7: 30,532,200 V120A probably damaging Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atp2a2 A G 5: 122,466,069 Y434H probably benign Het
Atrnl1 C T 19: 57,935,606 R1268* probably null Het
AW554918 A G 18: 25,289,849 probably null Het
Canx A G 11: 50,301,816 W324R probably damaging Het
Ccdc130 T C 8: 84,260,317 S184G probably damaging Het
Col9a1 A G 1: 24,185,343 E202G unknown Het
Crh C A 3: 19,694,254 A75S possibly damaging Het
Ctnnal1 T A 4: 56,817,299 probably null Het
Dmrta2 T A 4: 109,981,907 S284T possibly damaging Het
Dock1 T C 7: 134,782,748 V680A probably damaging Het
Duox2 G A 2: 122,295,176 R317C probably damaging Het
Elmod2 A G 8: 83,321,509 L108P probably damaging Het
Exoc6b A G 6: 84,848,810 S540P probably benign Het
Fsip2 C T 2: 82,982,130 A2931V possibly damaging Het
Gipc2 A T 3: 152,128,056 I196K probably damaging Het
Gli2 A G 1: 118,836,534 S1296P probably benign Het
Gm21103 T A 14: 6,301,894 Q173L probably damaging Het
Gpatch1 A T 7: 35,287,121 probably null Het
Grm8 G A 6: 27,760,176 T385I probably null Het
Gtf2f1 C A 17: 57,004,562 D283Y probably damaging Het
Hcar1 T A 5: 123,879,212 T139S possibly damaging Het
Hcrtr1 T A 4: 130,135,818 T157S possibly damaging Het
Htra2 T G 6: 83,051,539 Q436P possibly damaging Het
Igkv1-133 A G 6: 67,725,538 D80G probably benign Het
Il21 C A 3: 37,227,654 probably null Het
Inpp5f T A 7: 128,669,957 C359S probably benign Het
Itgb6 A T 2: 60,650,011 I327N probably damaging Het
Itgbl1 A T 14: 123,843,904 T232S probably damaging Het
Kif1a T A 1: 93,073,810 K266* probably null Het
Mcm10 C A 2: 5,006,517 E214D probably benign Het
Mefv T A 16: 3,713,053 I522F probably damaging Het
Naaladl2 T A 3: 24,058,176 I581F possibly damaging Het
Naip6 A T 13: 100,304,355 Y306N probably damaging Het
Olfr1224-ps1 A C 2: 89,156,510 F222V probably benign Het
Olfr172 T C 16: 58,760,505 T224A possibly damaging Het
Olfr621-ps1 A T 7: 103,629,759 M67K probably damaging Het
Olfr780 T A 10: 129,321,794 M57K probably benign Het
Opn1sw T A 6: 29,378,912 H247L probably benign Het
Pbxip1 C A 3: 89,445,633 F195L probably benign Het
Pcdh12 A T 18: 38,281,624 F816Y probably benign Het
Pi4k2b C A 5: 52,753,245 N290K probably damaging Het
Pias2 T C 18: 77,152,720 S598P possibly damaging Het
Ppfia4 A G 1: 134,313,100 V835A probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rnf213 A G 11: 119,452,575 I3589V Het
Scg2 T C 1: 79,436,985 Y7C probably benign Het
Sec16a A G 2: 26,441,592 V137A probably benign Het
Setdb1 G A 3: 95,339,913 T525I probably benign Het
Slc35e4 A T 11: 3,912,530 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Stk10 A G 11: 32,598,497 N355S probably benign Het
Supt6 A T 11: 78,207,616 D1716E probably damaging Het
Taok3 C T 5: 117,252,543 A523V probably benign Het
Tekt3 A G 11: 63,083,766 T304A possibly damaging Het
Ttc6 G T 12: 57,576,184 R123L probably benign Het
Tyw1 T A 5: 130,267,872 probably null Het
Ulk2 A G 11: 61,782,083 L895P probably damaging Het
Unc13c A T 9: 73,517,363 N1990K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wipf1 A G 2: 73,435,081 S393P probably damaging Het
Other mutations in Sgcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Sgcg APN 14 61240347 nonsense probably null
IGL00159:Sgcg APN 14 61232475 missense probably benign 0.00
R0466:Sgcg UTSW 14 61221686 missense probably damaging 1.00
R1236:Sgcg UTSW 14 61245770 missense probably damaging 0.99
R1870:Sgcg UTSW 14 61240447 splice site probably benign
R1879:Sgcg UTSW 14 61236897 critical splice acceptor site probably null
R1933:Sgcg UTSW 14 61232412 missense possibly damaging 0.77
R2090:Sgcg UTSW 14 61245764 missense probably damaging 0.99
R2937:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R2938:Sgcg UTSW 14 61229625 missense probably damaging 1.00
R3508:Sgcg UTSW 14 61221746 missense probably benign
R5345:Sgcg UTSW 14 61245769 missense probably damaging 0.99
R5464:Sgcg UTSW 14 61236855 missense possibly damaging 0.65
R5582:Sgcg UTSW 14 61225305 missense probably damaging 1.00
R7335:Sgcg UTSW 14 61240367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATGCCAGTGTAGGAGAGT -3'
(R):5'- AAAGTACCTTTCCCTCCTCTATGG -3'

Sequencing Primer
(F):5'- GGAATGTAACCTTGCACAGCCTTC -3'
(R):5'- GGGGGTTCATGTTAAAGC -3'
Posted On2019-06-26