Incidental Mutation 'R7259:Olfr172'
ID564505
Institutional Source Beutler Lab
Gene Symbol Olfr172
Ensembl Gene ENSMUSG00000071510
Gene Nameolfactory receptor 172
SynonymsGA_x54KRFPKG5P-54930346-54929417, MOR184-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7259 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58759544-58763176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58760505 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 224 (T224A)
Ref Sequence ENSEMBL: ENSMUSP00000150908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095991] [ENSMUST00000214139]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095991
AA Change: T224A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093690
Gene: ENSMUSG00000071510
AA Change: T224A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-52 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214139
AA Change: T224A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A G 13: 8,570,252 Y258C probably benign Het
Aebp2 A G 6: 140,633,768 S244G probably benign Het
Agl A T 3: 116,784,581 Y495N probably damaging Het
Arhgap33 A G 7: 30,532,200 V120A probably damaging Het
Asb14 C T 14: 26,903,455 H256Y probably benign Het
Atp2a2 A G 5: 122,466,069 Y434H probably benign Het
Atrnl1 C T 19: 57,935,606 R1268* probably null Het
AW554918 A G 18: 25,289,849 probably null Het
Canx A G 11: 50,301,816 W324R probably damaging Het
Ccdc130 T C 8: 84,260,317 S184G probably damaging Het
Col9a1 A G 1: 24,185,343 E202G unknown Het
Crh C A 3: 19,694,254 A75S possibly damaging Het
Ctnnal1 T A 4: 56,817,299 probably null Het
Dmrta2 T A 4: 109,981,907 S284T possibly damaging Het
Dock1 T C 7: 134,782,748 V680A probably damaging Het
Duox2 G A 2: 122,295,176 R317C probably damaging Het
Elmod2 A G 8: 83,321,509 L108P probably damaging Het
Exoc6b A G 6: 84,848,810 S540P probably benign Het
Fsip2 C T 2: 82,982,130 A2931V possibly damaging Het
Gipc2 A T 3: 152,128,056 I196K probably damaging Het
Gli2 A G 1: 118,836,534 S1296P probably benign Het
Gm21103 T A 14: 6,301,894 Q173L probably damaging Het
Gpatch1 A T 7: 35,287,121 probably null Het
Grm8 G A 6: 27,760,176 T385I probably null Het
Gtf2f1 C A 17: 57,004,562 D283Y probably damaging Het
Hcar1 T A 5: 123,879,212 T139S possibly damaging Het
Hcrtr1 T A 4: 130,135,818 T157S possibly damaging Het
Htra2 T G 6: 83,051,539 Q436P possibly damaging Het
Igkv1-133 A G 6: 67,725,538 D80G probably benign Het
Il21 C A 3: 37,227,654 probably null Het
Inpp5f T A 7: 128,669,957 C359S probably benign Het
Itgb6 A T 2: 60,650,011 I327N probably damaging Het
Itgbl1 A T 14: 123,843,904 T232S probably damaging Het
Kif1a T A 1: 93,073,810 K266* probably null Het
Mcm10 C A 2: 5,006,517 E214D probably benign Het
Mefv T A 16: 3,713,053 I522F probably damaging Het
Naaladl2 T A 3: 24,058,176 I581F possibly damaging Het
Naip6 A T 13: 100,304,355 Y306N probably damaging Het
Olfr1224-ps1 A C 2: 89,156,510 F222V probably benign Het
Olfr621-ps1 A T 7: 103,629,759 M67K probably damaging Het
Olfr780 T A 10: 129,321,794 M57K probably benign Het
Opn1sw T A 6: 29,378,912 H247L probably benign Het
Pbxip1 C A 3: 89,445,633 F195L probably benign Het
Pcdh12 A T 18: 38,281,624 F816Y probably benign Het
Pi4k2b C A 5: 52,753,245 N290K probably damaging Het
Pias2 T C 18: 77,152,720 S598P possibly damaging Het
Ppfia4 A G 1: 134,313,100 V835A probably damaging Het
Ptch1 T C 13: 63,573,294 K54E not run Het
Rnf213 A G 11: 119,452,575 I3589V Het
Scg2 T C 1: 79,436,985 Y7C probably benign Het
Sec16a A G 2: 26,441,592 V137A probably benign Het
Setdb1 G A 3: 95,339,913 T525I probably benign Het
Sgcg A T 14: 61,225,217 I227N probably benign Het
Slc35e4 A T 11: 3,912,530 probably null Het
Smarca2 C T 19: 26,654,464 Q560* probably null Het
Stk10 A G 11: 32,598,497 N355S probably benign Het
Supt6 A T 11: 78,207,616 D1716E probably damaging Het
Taok3 C T 5: 117,252,543 A523V probably benign Het
Tekt3 A G 11: 63,083,766 T304A possibly damaging Het
Ttc6 G T 12: 57,576,184 R123L probably benign Het
Tyw1 T A 5: 130,267,872 probably null Het
Ulk2 A G 11: 61,782,083 L895P probably damaging Het
Unc13c A T 9: 73,517,363 N1990K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wipf1 A G 2: 73,435,081 S393P probably damaging Het
Other mutations in Olfr172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03006:Olfr172 APN 16 58761148 missense probably benign 0.01
R1210:Olfr172 UTSW 16 58761050 missense probably damaging 1.00
R1521:Olfr172 UTSW 16 58760853 missense probably damaging 1.00
R1710:Olfr172 UTSW 16 58761141 missense probably benign 0.02
R4730:Olfr172 UTSW 16 58760742 missense probably benign 0.00
R4784:Olfr172 UTSW 16 58760548 missense probably damaging 1.00
R4924:Olfr172 UTSW 16 58760619 nonsense probably null
R5213:Olfr172 UTSW 16 58760621 missense probably damaging 1.00
R5967:Olfr172 UTSW 16 58760362 missense probably damaging 1.00
R7022:Olfr172 UTSW 16 58761119 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCCCTGTGTAATTTCATGTGAAG -3'
(R):5'- TTAGACTAGCATTCTGTGGGTC -3'

Sequencing Primer
(F):5'- TGGGTTTAGTAAGGGAACTACTATTG -3'
(R):5'- AGACTAGCATTCTGTGGGTCTAATC -3'
Posted On2019-06-26