Incidental Mutation 'R7260:Dnah14'
ID 564513
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 045352-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7260 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181534309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 2320 (R2320W)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000208001
AA Change: R2320W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,849,882 (GRCm39) S293P probably benign Het
Actn2 T C 13: 12,291,376 (GRCm39) N676S probably benign Het
Amfr C T 8: 94,702,776 (GRCm39) M463I possibly damaging Het
Ankdd1a G T 9: 65,411,834 (GRCm39) A325D probably damaging Het
Apba2 A G 7: 64,389,493 (GRCm39) D463G probably damaging Het
Arid5b A G 10: 67,933,637 (GRCm39) V755A probably damaging Het
Boc A T 16: 44,310,533 (GRCm39) F796I Het
Ccnt1 G A 15: 98,463,005 (GRCm39) Q56* probably null Het
Cd248 T A 19: 5,119,383 (GRCm39) Y410* probably null Het
Chd9 T A 8: 91,721,171 (GRCm39) N986K unknown Het
Col6a6 T C 9: 105,661,168 (GRCm39) T314A probably benign Het
Cpped1 A G 16: 11,646,327 (GRCm39) F142L possibly damaging Het
Csmd1 C T 8: 16,050,574 (GRCm39) A2221T probably damaging Het
Cyp2c69 C A 19: 39,831,344 (GRCm39) V490L probably benign Het
Cyrib A T 15: 63,829,438 (GRCm39) F23L possibly damaging Het
Dcst2 T C 3: 89,273,593 (GRCm39) F157S probably damaging Het
Ddx54 G T 5: 120,764,985 (GRCm39) R788L probably benign Het
Dnah1 T C 14: 30,991,343 (GRCm39) Y3145C probably damaging Het
Dnai3 T A 3: 145,752,295 (GRCm39) M794L probably benign Het
Emilin2 T C 17: 71,581,785 (GRCm39) T314A probably benign Het
Eml2 A G 7: 18,934,515 (GRCm39) S405G probably benign Het
Ephb2 A G 4: 136,498,885 (GRCm39) F65L probably damaging Het
Fbn2 T C 18: 58,199,188 (GRCm39) D1360G probably benign Het
Fbxo22 A G 9: 55,125,754 (GRCm39) T206A probably benign Het
Filip1l A G 16: 57,391,287 (GRCm39) E625G probably damaging Het
Gen1 A C 12: 11,306,849 (GRCm39) M172R probably damaging Het
Gk5 A G 9: 96,001,663 (GRCm39) K54E probably benign Het
Glis3 T C 19: 28,508,802 (GRCm39) E394G probably benign Het
Helq T A 5: 100,939,793 (GRCm39) E373D probably damaging Het
Ighv1-74 A G 12: 115,766,372 (GRCm39) F83L probably benign Het
Ints15 A G 5: 143,297,594 (GRCm39) V151A probably benign Het
Iqcn T C 8: 71,161,397 (GRCm39) Y197H probably benign Het
Kdm4d T C 9: 14,374,454 (GRCm39) D468G probably benign Het
Kif20b A G 19: 34,927,610 (GRCm39) I957M probably damaging Het
Ldhal6b A G 17: 5,468,535 (GRCm39) F133S possibly damaging Het
Loxhd1 T C 18: 77,420,338 (GRCm39) Y321H possibly damaging Het
Ltbp1 A T 17: 75,373,139 (GRCm39) M261L probably benign Het
Mical2 A T 7: 111,919,001 (GRCm39) Q430L probably benign Het
Mroh4 A T 15: 74,479,978 (GRCm39) N885K possibly damaging Het
Ms4a7 A G 19: 11,299,710 (GRCm39) Y231H probably damaging Het
Msh2 G T 17: 88,025,047 (GRCm39) V642F probably damaging Het
Muc5b G T 7: 141,396,385 (GRCm39) A166S unknown Het
Myo18b T C 5: 112,923,154 (GRCm39) I1868V probably benign Het
Nfatc3 T C 8: 106,835,578 (GRCm39) S975P probably benign Het
Oacyl T C 18: 65,831,438 (GRCm39) L25P probably damaging Het
Or12e10 A G 2: 87,640,731 (GRCm39) N189S probably damaging Het
Or5b109 T C 19: 13,212,388 (GRCm39) F258S probably damaging Het
Or5w15 T C 2: 87,568,852 (GRCm39) probably null Het
Or6c69 T A 10: 129,748,156 (GRCm39) probably benign Het
Or8a1 T A 9: 37,642,049 (GRCm39) I77F probably damaging Het
Patj A G 4: 98,304,970 (GRCm39) I275V possibly damaging Het
Pdcd11 G A 19: 47,117,673 (GRCm39) R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Phkb T A 8: 86,604,759 (GRCm39) Y55N probably benign Het
Pias4 A G 10: 80,993,302 (GRCm39) V207A possibly damaging Het
Plxna4 C A 6: 32,216,455 (GRCm39) R540L possibly damaging Het
Psapl1 G A 5: 36,362,556 (GRCm39) V383M probably benign Het
Rars1 C A 11: 35,725,281 (GRCm39) A10S probably benign Het
Rhobtb1 A T 10: 69,106,610 (GRCm39) K454* probably null Het
Rmnd1 A T 10: 4,364,803 (GRCm39) probably null Het
Rnf213 A G 11: 119,343,401 (GRCm39) I3589V Het
Rngtt T C 4: 33,356,176 (GRCm39) S338P possibly damaging Het
Sh3bgr A G 16: 96,025,681 (GRCm39) E189G unknown Het
Slc30a3 G A 5: 31,245,690 (GRCm39) T281I probably damaging Het
Smok3c T A 5: 138,063,885 (GRCm39) D457E possibly damaging Het
Stard9 C A 2: 120,537,419 (GRCm39) Q4274K possibly damaging Het
Syne2 G T 12: 75,991,853 (GRCm39) L1938F probably damaging Het
Tmem70 C A 1: 16,735,590 (GRCm39) T20K possibly damaging Het
Tnrc6a A G 7: 122,785,813 (GRCm39) E1502G probably benign Het
Tpp1 A T 7: 105,396,704 (GRCm39) S438T probably benign Het
Tubb2a T A 13: 34,259,397 (GRCm39) Q131L probably damaging Het
Ube2v1 A G 2: 167,471,114 (GRCm39) S26P probably benign Het
Unc13a G T 8: 72,113,229 (GRCm39) S207R possibly damaging Het
Usp35 T G 7: 96,969,286 (GRCm39) D362A probably damaging Het
Utp20 A G 10: 88,587,334 (GRCm39) I2487T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r117 T A 17: 23,694,359 (GRCm39) H496L probably benign Het
Vmn2r92 C T 17: 18,387,138 (GRCm39) A159V probably damaging Het
Wiz T C 17: 32,578,085 (GRCm39) K467E probably damaging Het
Zfp534 T C 4: 147,759,461 (GRCm39) T403A probably benign Het
Zswim5 T C 4: 116,819,843 (GRCm39) L416P probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,455,517 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGTTAGCAGCTAGATTCATTCC -3'
(R):5'- CTTCCCACAGACTGTGTTTGAAAC -3'

Sequencing Primer
(F):5'- ACAGACTTTTACAAGGGGCTTG -3'
(R):5'- GACTGTGTTTGAAACCAACAATTCC -3'
Posted On 2019-06-26