Incidental Mutation 'R0582:Nfe2l2'
ID56452
Institutional Source Beutler Lab
Gene Symbol Nfe2l2
Ensembl Gene ENSMUSG00000015839
Gene Namenuclear factor, erythroid derived 2, like 2
SynonymsNrf2
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R0582 (G1)
Quality Score191
Status Validated
Chromosome2
Chromosomal Location75675513-75704641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75676768 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 329 (E329D)
Ref Sequence ENSEMBL: ENSMUSP00000099733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102672]
PDB Structure Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Crystal structure of the Keap1 protein in complexed with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102672
AA Change: E329D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099733
Gene: ENSMUSG00000015839
AA Change: E329D

DomainStartEndE-ValueType
PDB:3WN7|M 17 42 8e-10 PDB
low complexity region 43 68 N/A INTRINSIC
BRLZ 487 551 6.46e-9 SMART
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters; many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to oxidative stress in a variety of organs and cells including brain, liver, erythrocytes, and spleen, abnormal tooth enamel, and abnormal response to various injuries, chemical treatments, and induced inflammatory diseases. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Nfe2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Nfe2l2 APN 2 75679413 missense probably damaging 1.00
IGL00931:Nfe2l2 APN 2 75675998 missense probably damaging 1.00
IGL02207:Nfe2l2 APN 2 75678525 missense probably damaging 1.00
IGL03356:Nfe2l2 APN 2 75679200 missense probably benign 0.00
Scarlett UTSW 2 75679413 missense probably damaging 1.00
R0782:Nfe2l2 UTSW 2 75676833 missense probably benign 0.12
R1139:Nfe2l2 UTSW 2 75676886 missense probably benign 0.00
R2237:Nfe2l2 UTSW 2 75676554 missense probably benign 0.03
R2239:Nfe2l2 UTSW 2 75676554 missense probably benign 0.03
R4365:Nfe2l2 UTSW 2 75679428 missense probably damaging 1.00
R5240:Nfe2l2 UTSW 2 75676009 missense possibly damaging 0.63
R5328:Nfe2l2 UTSW 2 75676856 missense probably damaging 1.00
R5666:Nfe2l2 UTSW 2 75677118 missense probably benign 0.01
R5670:Nfe2l2 UTSW 2 75677118 missense probably benign 0.01
R6142:Nfe2l2 UTSW 2 75679417 missense probably damaging 0.99
R6315:Nfe2l2 UTSW 2 75676819 missense probably damaging 1.00
R6520:Nfe2l2 UTSW 2 75676568 missense probably benign 0.00
R7621:Nfe2l2 UTSW 2 75679413 missense probably damaging 1.00
R8110:Nfe2l2 UTSW 2 75679421 missense probably benign 0.03
Z1176:Nfe2l2 UTSW 2 75679164 missense probably null 0.68
Z1177:Nfe2l2 UTSW 2 75676779 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGATGACCAGGACTCACGGGAAC -3'
(R):5'- CTTTCATAGCAGAGCCCAGTGACG -3'

Sequencing Primer
(F):5'- CACATTGGGATTCACGCATAG -3'
(R):5'- CCCAGTGACGGTGGCAG -3'
Posted On2013-07-11