Incidental Mutation 'R0582:Pdyn'
ID56453
Institutional Source Beutler Lab
Gene Symbol Pdyn
Ensembl Gene ENSMUSG00000027400
Gene Nameprodynorphin
SynonymsDyn
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0582 (G1)
Quality Score128
Status Validated
Chromosome2
Chromosomal Location129686565-129699844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129689738 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 44 (L44R)
Ref Sequence ENSEMBL: ENSMUSP00000114534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028883] [ENSMUST00000130608]
Predicted Effect probably damaging
Transcript: ENSMUST00000028883
AA Change: L44R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028883
Gene: ENSMUSG00000027400
AA Change: L44R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Opiods_neuropep 22 68 8.7e-20 PFAM
low complexity region 96 109 N/A INTRINSIC
internal_repeat_1 164 208 1.79e-5 PROSPERO
internal_repeat_1 200 227 1.79e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000130608
AA Change: L44R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114534
Gene: ENSMUSG00000027400
AA Change: L44R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Opiods_neuropep 22 70 1e-21 PFAM
Meta Mutation Damage Score 0.7998 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a number of active opium-like peptides. These peptides are the endogenous ligands for the Kappa-opioid receptor and similar G-protein-coupled receptors and are thought to function as the body's natural way to control addiction. These peptides have been associated with depression, stress, anxiety, response to pain, and maintenance of homeostasis via circadian rhythms and control of appetite. Mutations in the related human gene have been linked to the neurodegenerative disease spinocerebellar ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high postnatal mortality, impaired thermoregulation, and loss of white fat. Survivors show ketosis, microvesicular fat accumulation, elevated serum lipids, and behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Pdyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Pdyn APN 2 129688518 missense probably damaging 1.00
R1937:Pdyn UTSW 2 129689809 missense probably benign
R4970:Pdyn UTSW 2 129688101 missense probably damaging 1.00
R6171:Pdyn UTSW 2 129688348 missense possibly damaging 0.93
R7641:Pdyn UTSW 2 129689828 missense possibly damaging 0.95
R8197:Pdyn UTSW 2 129688357 missense probably benign 0.00
R8389:Pdyn UTSW 2 129688437 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GACATGGCCTCTATGCAGACCTTG -3'
(R):5'- TGCTGCTCTTACACCACACACG -3'

Sequencing Primer
(F):5'- TTGGGGAGCCATGGTAATGAAG -3'
(R):5'- CGAGTAAGAGGTGGCCTTGTC -3'
Posted On2013-07-11