Incidental Mutation 'R0582:Tm4sf4'
ID 56454
Institutional Source Beutler Lab
Gene Symbol Tm4sf4
Ensembl Gene ENSMUSG00000027801
Gene Name transmembrane 4 superfamily member 4
Synonyms il-TMP
MMRRC Submission 038772-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0582 (G1)
Quality Score 122
Status Validated
Chromosome 3
Chromosomal Location 57332831-57349098 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 57341278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029377]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029377
SMART Domains Protein: ENSMUSP00000029377
Gene: ENSMUSG00000027801

DomainStartEndE-ValueType
Pfam:L6_membrane 1 191 2.7e-80 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that can regulate cell proliferation.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,904,147 (GRCm39) M186K probably benign Het
Afm T C 5: 90,672,639 (GRCm39) probably benign Het
Arfgef3 G A 10: 18,487,038 (GRCm39) A1332V probably damaging Het
Atp11a T C 8: 12,881,214 (GRCm39) S451P probably benign Het
Birc6 T A 17: 74,950,332 (GRCm39) V3189E probably damaging Het
Ccdc150 C T 1: 54,368,670 (GRCm39) A626V probably benign Het
Ccdc50 G A 16: 27,263,409 (GRCm39) probably benign Het
Cntln T C 4: 84,802,978 (GRCm39) S93P probably damaging Het
Ctnna2 C A 6: 77,735,400 (GRCm39) V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 (GRCm39) Q668E probably damaging Het
Cyp1a2 G A 9: 57,587,529 (GRCm39) probably benign Het
Dnah8 A G 17: 30,937,935 (GRCm39) D1604G probably benign Het
Dscaml1 A T 9: 45,579,562 (GRCm39) I370F possibly damaging Het
Duxf4 A T 10: 58,071,508 (GRCm39) S235R probably benign Het
Ears2 T C 7: 121,654,881 (GRCm39) E129G probably benign Het
Igsf10 T C 3: 59,227,188 (GRCm39) I2162V probably benign Het
Ints9 C T 14: 65,217,598 (GRCm39) P42S probably damaging Het
Ipp T C 4: 116,372,664 (GRCm39) L231S probably damaging Het
Lyn T A 4: 3,743,296 (GRCm39) L72Q probably damaging Het
Nfe2l2 T A 2: 75,507,112 (GRCm39) E329D probably damaging Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or52a24 G A 7: 103,381,880 (GRCm39) C249Y possibly damaging Het
Pdyn A C 2: 129,531,658 (GRCm39) L44R probably damaging Het
Pkd1l1 A G 11: 8,881,699 (GRCm39) probably benign Het
Prpf40a A T 2: 53,035,704 (GRCm39) F695L probably damaging Het
Rnf217 A G 10: 31,484,763 (GRCm39) Y140H possibly damaging Het
Sema6c C T 3: 95,076,508 (GRCm39) R265C probably damaging Het
Slc7a8 C A 14: 54,995,901 (GRCm39) C167F probably damaging Het
Snap47 A T 11: 59,319,259 (GRCm39) L293* probably null Het
Snx3 A T 10: 42,409,276 (GRCm39) probably benign Het
Sycp2l T A 13: 41,291,431 (GRCm39) probably benign Het
Taar3 A G 10: 23,825,715 (GRCm39) Y87C probably damaging Het
Tssc4 T C 7: 142,624,246 (GRCm39) S185P probably damaging Het
Ttc28 G T 5: 111,331,162 (GRCm39) A430S probably damaging Het
Ulbp3 G A 10: 3,075,082 (GRCm39) noncoding transcript Het
Vmn2r27 T C 6: 124,201,249 (GRCm39) D236G probably benign Het
Vps54 G T 11: 21,250,137 (GRCm39) D508Y probably damaging Het
Wdr53 G A 16: 32,070,726 (GRCm39) V24M probably damaging Het
Xirp2 T G 2: 67,339,210 (GRCm39) L484V probably benign Het
Zfyve26 T C 12: 79,292,996 (GRCm39) D2051G probably damaging Het
Other mutations in Tm4sf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Tm4sf4 APN 3 57,333,939 (GRCm39) nonsense probably null
A4554:Tm4sf4 UTSW 3 57,345,188 (GRCm39) critical splice donor site probably null
R2396:Tm4sf4 UTSW 3 57,345,181 (GRCm39) missense unknown
R3104:Tm4sf4 UTSW 3 57,345,043 (GRCm39) missense possibly damaging 0.86
R3105:Tm4sf4 UTSW 3 57,345,043 (GRCm39) missense possibly damaging 0.86
R3106:Tm4sf4 UTSW 3 57,345,043 (GRCm39) missense possibly damaging 0.86
R3888:Tm4sf4 UTSW 3 57,345,166 (GRCm39) nonsense probably null
R5279:Tm4sf4 UTSW 3 57,341,159 (GRCm39) missense probably benign 0.00
R6287:Tm4sf4 UTSW 3 57,333,112 (GRCm39) missense probably damaging 1.00
R7328:Tm4sf4 UTSW 3 57,333,925 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGGCCATCATGTTCAGCGTCAG -3'
(R):5'- TTTGGATGGGACAGGTGACACAAC -3'

Sequencing Primer
(F):5'- TATACTGAATGGCGTAACTGGAC -3'
(R):5'- TTTCTCCAGATAACTGAGGCATC -3'
Posted On 2013-07-11