Incidental Mutation 'R0582:Sema6c'
ID 56456
Institutional Source Beutler Lab
Gene Symbol Sema6c
Ensembl Gene ENSMUSG00000038777
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms Sema Y, Semay
MMRRC Submission 038772-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.273) question?
Stock # R0582 (G1)
Quality Score 172
Status Validated
Chromosome 3
Chromosomal Location 95160457-95174024 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95169197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 265 (R265C)
Ref Sequence ENSEMBL: ENSMUSP00000144039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090821] [ENSMUST00000090823] [ENSMUST00000107217] [ENSMUST00000131620] [ENSMUST00000131742] [ENSMUST00000142449] [ENSMUST00000168321] [ENSMUST00000202315] [ENSMUST00000204709]
AlphaFold Q9WTM3
Predicted Effect probably damaging
Transcript: ENSMUST00000090821
AA Change: R265C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088331
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090823
AA Change: R265C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088333
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107217
AA Change: R225C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102835
Gene: ENSMUSG00000038777
AA Change: R225C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 448 1.23e-126 SMART
low complexity region 551 563 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 652 661 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
low complexity region 899 916 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130814
Predicted Effect probably benign
Transcript: ENSMUST00000131620
SMART Domains Protein: ENSMUSP00000138154
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142306
Predicted Effect probably benign
Transcript: ENSMUST00000142449
SMART Domains Protein: ENSMUSP00000123457
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168321
AA Change: R265C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129081
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202315
AA Change: R265C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144039
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204709
SMART Domains Protein: ENSMUSP00000144702
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
PDB:3OKY|B 25 117 8e-8 PDB
Blast:Sema 62 119 9e-34 BLAST
Meta Mutation Damage Score 0.2184 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family. Semaphorins represent important molecular signals controlling multiple aspects of the cellular response that follows CNS injury, and thus may play an important role in neural regeneration. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display a decrease in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Sema6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Sema6c APN 3 95172398 missense probably damaging 1.00
IGL01631:Sema6c APN 3 95170403 missense probably benign 0.10
IGL01799:Sema6c APN 3 95170831 missense probably damaging 1.00
IGL02237:Sema6c APN 3 95170119 missense probably damaging 1.00
IGL02852:Sema6c APN 3 95169984 splice site probably benign
IGL02874:Sema6c APN 3 95170377 missense probably damaging 1.00
IGL03003:Sema6c APN 3 95169614 missense probably damaging 1.00
BB005:Sema6c UTSW 3 95172309 missense probably damaging 1.00
BB015:Sema6c UTSW 3 95172309 missense probably damaging 1.00
PIT4418001:Sema6c UTSW 3 95170090 missense possibly damaging 0.57
R0558:Sema6c UTSW 3 95168691 missense probably damaging 1.00
R0590:Sema6c UTSW 3 95172623 missense probably damaging 1.00
R0685:Sema6c UTSW 3 95172710 missense possibly damaging 0.46
R1056:Sema6c UTSW 3 95171216 missense probably benign 0.15
R1721:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1867:Sema6c UTSW 3 95170788 missense probably damaging 0.98
R1868:Sema6c UTSW 3 95170813 missense probably damaging 0.99
R2016:Sema6c UTSW 3 95171234 missense probably benign 0.00
R2343:Sema6c UTSW 3 95167083 missense probably damaging 1.00
R2898:Sema6c UTSW 3 95172818 missense probably damaging 1.00
R4095:Sema6c UTSW 3 95173194 missense probably benign 0.03
R4999:Sema6c UTSW 3 95168363 missense probably damaging 1.00
R5263:Sema6c UTSW 3 95173152 missense probably benign 0.02
R6914:Sema6c UTSW 3 95173208 missense probably benign 0.00
R6942:Sema6c UTSW 3 95173208 missense probably benign 0.00
R7104:Sema6c UTSW 3 95168845 missense possibly damaging 0.95
R7524:Sema6c UTSW 3 95167060 missense probably benign 0.20
R7724:Sema6c UTSW 3 95173199 missense probably damaging 1.00
R7928:Sema6c UTSW 3 95172309 missense probably damaging 1.00
R8045:Sema6c UTSW 3 95173224 missense probably benign 0.27
R8243:Sema6c UTSW 3 95172605 missense probably damaging 1.00
R8790:Sema6c UTSW 3 95168030 missense probably benign 0.34
R9607:Sema6c UTSW 3 95169234 missense probably benign 0.03
R9653:Sema6c UTSW 3 95173214 missense probably benign 0.40
Z1177:Sema6c UTSW 3 95168328 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGCGTTGGAGCATGGAGAGCAC -3'
(R):5'- GCAGCAAACTGGCCTTGCTTGAAG -3'

Sequencing Primer
(F):5'- ATGGATGCTGGACAGTTCTCC -3'
(R):5'- CCAACCTATTGGTCTGAGTAGTGAAG -3'
Posted On 2013-07-11