Incidental Mutation 'R0582:Sema6c'
ID 56456
Institutional Source Beutler Lab
Gene Symbol Sema6c
Ensembl Gene ENSMUSG00000038777
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms Sema Y, Semay
MMRRC Submission 038772-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.303) question?
Stock # R0582 (G1)
Quality Score 172
Status Validated
Chromosome 3
Chromosomal Location 95067768-95081335 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95076508 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 265 (R265C)
Ref Sequence ENSEMBL: ENSMUSP00000144039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090821] [ENSMUST00000090823] [ENSMUST00000107217] [ENSMUST00000131620] [ENSMUST00000131742] [ENSMUST00000168321] [ENSMUST00000202315] [ENSMUST00000204709] [ENSMUST00000142449]
AlphaFold Q9WTM3
Predicted Effect probably damaging
Transcript: ENSMUST00000090821
AA Change: R265C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088331
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090823
AA Change: R265C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088333
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107217
AA Change: R225C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102835
Gene: ENSMUSG00000038777
AA Change: R225C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 448 1.23e-126 SMART
low complexity region 551 563 N/A INTRINSIC
transmembrane domain 596 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 652 661 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
low complexity region 899 916 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130814
Predicted Effect probably benign
Transcript: ENSMUST00000131620
SMART Domains Protein: ENSMUSP00000138154
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134125
Predicted Effect probably damaging
Transcript: ENSMUST00000168321
AA Change: R265C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129081
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202315
AA Change: R265C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144039
Gene: ENSMUSG00000038777
AA Change: R265C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 646 658 N/A INTRINSIC
low complexity region 660 669 N/A INTRINSIC
low complexity region 693 709 N/A INTRINSIC
low complexity region 744 761 N/A INTRINSIC
low complexity region 907 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204709
SMART Domains Protein: ENSMUSP00000144702
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
PDB:3OKY|B 25 117 8e-8 PDB
Blast:Sema 62 119 9e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141607
Predicted Effect probably benign
Transcript: ENSMUST00000142449
SMART Domains Protein: ENSMUSP00000123457
Gene: ENSMUSG00000038777

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Sema 62 488 2.55e-165 SMART
low complexity region 591 603 N/A INTRINSIC
transmembrane domain 636 658 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
low complexity region 692 701 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
low complexity region 776 793 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
Meta Mutation Damage Score 0.2184 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family. Semaphorins represent important molecular signals controlling multiple aspects of the cellular response that follows CNS injury, and thus may play an important role in neural regeneration. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display a decrease in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,904,147 (GRCm39) M186K probably benign Het
Afm T C 5: 90,672,639 (GRCm39) probably benign Het
Arfgef3 G A 10: 18,487,038 (GRCm39) A1332V probably damaging Het
Atp11a T C 8: 12,881,214 (GRCm39) S451P probably benign Het
Birc6 T A 17: 74,950,332 (GRCm39) V3189E probably damaging Het
Ccdc150 C T 1: 54,368,670 (GRCm39) A626V probably benign Het
Ccdc50 G A 16: 27,263,409 (GRCm39) probably benign Het
Cntln T C 4: 84,802,978 (GRCm39) S93P probably damaging Het
Ctnna2 C A 6: 77,735,400 (GRCm39) V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 (GRCm39) Q668E probably damaging Het
Cyp1a2 G A 9: 57,587,529 (GRCm39) probably benign Het
Dnah8 A G 17: 30,937,935 (GRCm39) D1604G probably benign Het
Dscaml1 A T 9: 45,579,562 (GRCm39) I370F possibly damaging Het
Duxf4 A T 10: 58,071,508 (GRCm39) S235R probably benign Het
Ears2 T C 7: 121,654,881 (GRCm39) E129G probably benign Het
Igsf10 T C 3: 59,227,188 (GRCm39) I2162V probably benign Het
Ints9 C T 14: 65,217,598 (GRCm39) P42S probably damaging Het
Ipp T C 4: 116,372,664 (GRCm39) L231S probably damaging Het
Lyn T A 4: 3,743,296 (GRCm39) L72Q probably damaging Het
Nfe2l2 T A 2: 75,507,112 (GRCm39) E329D probably damaging Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or52a24 G A 7: 103,381,880 (GRCm39) C249Y possibly damaging Het
Pdyn A C 2: 129,531,658 (GRCm39) L44R probably damaging Het
Pkd1l1 A G 11: 8,881,699 (GRCm39) probably benign Het
Prpf40a A T 2: 53,035,704 (GRCm39) F695L probably damaging Het
Rnf217 A G 10: 31,484,763 (GRCm39) Y140H possibly damaging Het
Slc7a8 C A 14: 54,995,901 (GRCm39) C167F probably damaging Het
Snap47 A T 11: 59,319,259 (GRCm39) L293* probably null Het
Snx3 A T 10: 42,409,276 (GRCm39) probably benign Het
Sycp2l T A 13: 41,291,431 (GRCm39) probably benign Het
Taar3 A G 10: 23,825,715 (GRCm39) Y87C probably damaging Het
Tm4sf4 T C 3: 57,341,278 (GRCm39) probably benign Het
Tssc4 T C 7: 142,624,246 (GRCm39) S185P probably damaging Het
Ttc28 G T 5: 111,331,162 (GRCm39) A430S probably damaging Het
Ulbp3 G A 10: 3,075,082 (GRCm39) noncoding transcript Het
Vmn2r27 T C 6: 124,201,249 (GRCm39) D236G probably benign Het
Vps54 G T 11: 21,250,137 (GRCm39) D508Y probably damaging Het
Wdr53 G A 16: 32,070,726 (GRCm39) V24M probably damaging Het
Xirp2 T G 2: 67,339,210 (GRCm39) L484V probably benign Het
Zfyve26 T C 12: 79,292,996 (GRCm39) D2051G probably damaging Het
Other mutations in Sema6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Sema6c APN 3 95,079,709 (GRCm39) missense probably damaging 1.00
IGL01631:Sema6c APN 3 95,077,714 (GRCm39) missense probably benign 0.10
IGL01799:Sema6c APN 3 95,078,142 (GRCm39) missense probably damaging 1.00
IGL02237:Sema6c APN 3 95,077,430 (GRCm39) missense probably damaging 1.00
IGL02852:Sema6c APN 3 95,077,295 (GRCm39) splice site probably benign
IGL02874:Sema6c APN 3 95,077,688 (GRCm39) missense probably damaging 1.00
IGL03003:Sema6c APN 3 95,076,925 (GRCm39) missense probably damaging 1.00
BB005:Sema6c UTSW 3 95,079,620 (GRCm39) missense probably damaging 1.00
BB015:Sema6c UTSW 3 95,079,620 (GRCm39) missense probably damaging 1.00
PIT4418001:Sema6c UTSW 3 95,077,401 (GRCm39) missense possibly damaging 0.57
R0558:Sema6c UTSW 3 95,076,002 (GRCm39) missense probably damaging 1.00
R0590:Sema6c UTSW 3 95,079,934 (GRCm39) missense probably damaging 1.00
R0685:Sema6c UTSW 3 95,080,021 (GRCm39) missense possibly damaging 0.46
R1056:Sema6c UTSW 3 95,078,527 (GRCm39) missense probably benign 0.15
R1721:Sema6c UTSW 3 95,078,099 (GRCm39) missense probably damaging 0.98
R1867:Sema6c UTSW 3 95,078,099 (GRCm39) missense probably damaging 0.98
R1868:Sema6c UTSW 3 95,078,124 (GRCm39) missense probably damaging 0.99
R2016:Sema6c UTSW 3 95,078,545 (GRCm39) missense probably benign 0.00
R2343:Sema6c UTSW 3 95,074,394 (GRCm39) missense probably damaging 1.00
R2898:Sema6c UTSW 3 95,080,129 (GRCm39) missense probably damaging 1.00
R4095:Sema6c UTSW 3 95,080,505 (GRCm39) missense probably benign 0.03
R4999:Sema6c UTSW 3 95,075,674 (GRCm39) missense probably damaging 1.00
R5263:Sema6c UTSW 3 95,080,463 (GRCm39) missense probably benign 0.02
R6914:Sema6c UTSW 3 95,080,519 (GRCm39) missense probably benign 0.00
R6942:Sema6c UTSW 3 95,080,519 (GRCm39) missense probably benign 0.00
R7104:Sema6c UTSW 3 95,076,156 (GRCm39) missense possibly damaging 0.95
R7524:Sema6c UTSW 3 95,074,371 (GRCm39) missense probably benign 0.20
R7724:Sema6c UTSW 3 95,080,510 (GRCm39) missense probably damaging 1.00
R7928:Sema6c UTSW 3 95,079,620 (GRCm39) missense probably damaging 1.00
R8045:Sema6c UTSW 3 95,080,535 (GRCm39) missense probably benign 0.27
R8243:Sema6c UTSW 3 95,079,916 (GRCm39) missense probably damaging 1.00
R8790:Sema6c UTSW 3 95,075,341 (GRCm39) missense probably benign 0.34
R9607:Sema6c UTSW 3 95,076,545 (GRCm39) missense probably benign 0.03
R9653:Sema6c UTSW 3 95,080,525 (GRCm39) missense probably benign 0.40
Z1177:Sema6c UTSW 3 95,075,639 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGCGTTGGAGCATGGAGAGCAC -3'
(R):5'- GCAGCAAACTGGCCTTGCTTGAAG -3'

Sequencing Primer
(F):5'- ATGGATGCTGGACAGTTCTCC -3'
(R):5'- CCAACCTATTGGTCTGAGTAGTGAAG -3'
Posted On 2013-07-11