Incidental Mutation 'R0582:Lyn'
ID 56457
Institutional Source Beutler Lab
Gene Symbol Lyn
Ensembl Gene ENSMUSG00000042228
Gene Name LYN proto-oncogene, Src family tyrosine kinase
Synonyms Hck-2, Yamaguchi sarcoma viral (v-yes-1) oncogene homolog
MMRRC Submission 038772-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0582 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 3676865-3791612 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3743296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 72 (L72Q)
Ref Sequence ENSEMBL: ENSMUSP00000100075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]
AlphaFold P25911
Predicted Effect probably damaging
Transcript: ENSMUST00000041377
AA Change: L93Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: L93Q

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103010
AA Change: L72Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: L72Q

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145083
Meta Mutation Damage Score 0.6605 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,904,147 (GRCm39) M186K probably benign Het
Afm T C 5: 90,672,639 (GRCm39) probably benign Het
Arfgef3 G A 10: 18,487,038 (GRCm39) A1332V probably damaging Het
Atp11a T C 8: 12,881,214 (GRCm39) S451P probably benign Het
Birc6 T A 17: 74,950,332 (GRCm39) V3189E probably damaging Het
Ccdc150 C T 1: 54,368,670 (GRCm39) A626V probably benign Het
Ccdc50 G A 16: 27,263,409 (GRCm39) probably benign Het
Cntln T C 4: 84,802,978 (GRCm39) S93P probably damaging Het
Ctnna2 C A 6: 77,735,400 (GRCm39) V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 (GRCm39) Q668E probably damaging Het
Cyp1a2 G A 9: 57,587,529 (GRCm39) probably benign Het
Dnah8 A G 17: 30,937,935 (GRCm39) D1604G probably benign Het
Dscaml1 A T 9: 45,579,562 (GRCm39) I370F possibly damaging Het
Duxf4 A T 10: 58,071,508 (GRCm39) S235R probably benign Het
Ears2 T C 7: 121,654,881 (GRCm39) E129G probably benign Het
Igsf10 T C 3: 59,227,188 (GRCm39) I2162V probably benign Het
Ints9 C T 14: 65,217,598 (GRCm39) P42S probably damaging Het
Ipp T C 4: 116,372,664 (GRCm39) L231S probably damaging Het
Nfe2l2 T A 2: 75,507,112 (GRCm39) E329D probably damaging Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or52a24 G A 7: 103,381,880 (GRCm39) C249Y possibly damaging Het
Pdyn A C 2: 129,531,658 (GRCm39) L44R probably damaging Het
Pkd1l1 A G 11: 8,881,699 (GRCm39) probably benign Het
Prpf40a A T 2: 53,035,704 (GRCm39) F695L probably damaging Het
Rnf217 A G 10: 31,484,763 (GRCm39) Y140H possibly damaging Het
Sema6c C T 3: 95,076,508 (GRCm39) R265C probably damaging Het
Slc7a8 C A 14: 54,995,901 (GRCm39) C167F probably damaging Het
Snap47 A T 11: 59,319,259 (GRCm39) L293* probably null Het
Snx3 A T 10: 42,409,276 (GRCm39) probably benign Het
Sycp2l T A 13: 41,291,431 (GRCm39) probably benign Het
Taar3 A G 10: 23,825,715 (GRCm39) Y87C probably damaging Het
Tm4sf4 T C 3: 57,341,278 (GRCm39) probably benign Het
Tssc4 T C 7: 142,624,246 (GRCm39) S185P probably damaging Het
Ttc28 G T 5: 111,331,162 (GRCm39) A430S probably damaging Het
Ulbp3 G A 10: 3,075,082 (GRCm39) noncoding transcript Het
Vmn2r27 T C 6: 124,201,249 (GRCm39) D236G probably benign Het
Vps54 G T 11: 21,250,137 (GRCm39) D508Y probably damaging Het
Wdr53 G A 16: 32,070,726 (GRCm39) V24M probably damaging Het
Xirp2 T G 2: 67,339,210 (GRCm39) L484V probably benign Het
Zfyve26 T C 12: 79,292,996 (GRCm39) D2051G probably damaging Het
Other mutations in Lyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3,743,286 (GRCm39) missense probably benign
IGL02744:Lyn APN 4 3,738,808 (GRCm39) missense probably benign 0.00
IGL02860:Lyn APN 4 3,745,594 (GRCm39) missense possibly damaging 0.77
IGL03328:Lyn APN 4 3,745,327 (GRCm39) missense probably benign 0.01
IGL03370:Lyn APN 4 3,780,931 (GRCm39) missense possibly damaging 0.81
bibb UTSW 4 3,783,055 (GRCm39) missense probably damaging 1.00
butterhead UTSW 4 3,748,765 (GRCm39) missense probably benign 0.11
Cress UTSW 4 3,789,908 (GRCm39) nonsense probably null
Friede UTSW 4 3,789,834 (GRCm39) nonsense probably null
Kohlrabi UTSW 4 3,783,089 (GRCm39) missense possibly damaging 0.74
lechuga UTSW 4 3,783,050 (GRCm39) missense probably damaging 1.00
Lemon UTSW 4 3,746,768 (GRCm39) missense probably damaging 1.00
Pacific UTSW 4 3,745,330 (GRCm39) missense probably damaging 1.00
water UTSW 4 3,748,787 (GRCm39) missense possibly damaging 0.93
R0079:Lyn UTSW 4 3,746,768 (GRCm39) missense probably damaging 1.00
R0089:Lyn UTSW 4 3,748,768 (GRCm39) missense probably benign 0.23
R0747:Lyn UTSW 4 3,745,638 (GRCm39) splice site probably benign
R1460:Lyn UTSW 4 3,789,908 (GRCm39) nonsense probably null
R1615:Lyn UTSW 4 3,748,765 (GRCm39) missense probably benign 0.11
R1654:Lyn UTSW 4 3,789,912 (GRCm39) missense probably damaging 0.99
R1703:Lyn UTSW 4 3,738,867 (GRCm39) splice site probably null
R2301:Lyn UTSW 4 3,780,959 (GRCm39) missense probably damaging 1.00
R2421:Lyn UTSW 4 3,748,787 (GRCm39) missense possibly damaging 0.93
R2512:Lyn UTSW 4 3,745,542 (GRCm39) missense probably benign 0.01
R3418:Lyn UTSW 4 3,746,833 (GRCm39) missense probably damaging 0.97
R3419:Lyn UTSW 4 3,746,833 (GRCm39) missense probably damaging 0.97
R3701:Lyn UTSW 4 3,742,455 (GRCm39) missense probably benign
R3702:Lyn UTSW 4 3,742,455 (GRCm39) missense probably benign
R3736:Lyn UTSW 4 3,745,330 (GRCm39) missense probably damaging 1.00
R4350:Lyn UTSW 4 3,789,796 (GRCm39) missense probably damaging 0.99
R4351:Lyn UTSW 4 3,789,796 (GRCm39) missense probably damaging 0.99
R4352:Lyn UTSW 4 3,789,796 (GRCm39) missense probably damaging 0.99
R4649:Lyn UTSW 4 3,738,850 (GRCm39) missense probably benign
R5738:Lyn UTSW 4 3,782,987 (GRCm39) missense probably damaging 1.00
R5875:Lyn UTSW 4 3,745,631 (GRCm39) splice site probably null
R6375:Lyn UTSW 4 3,745,527 (GRCm39) missense probably damaging 1.00
R7029:Lyn UTSW 4 3,782,996 (GRCm39) missense probably damaging 0.98
R7621:Lyn UTSW 4 3,789,834 (GRCm39) nonsense probably null
R7726:Lyn UTSW 4 3,756,428 (GRCm39) nonsense probably null
R7940:Lyn UTSW 4 3,783,089 (GRCm39) missense possibly damaging 0.74
R8169:Lyn UTSW 4 3,783,050 (GRCm39) missense probably damaging 1.00
R8341:Lyn UTSW 4 3,743,304 (GRCm39) critical splice donor site probably null
R8782:Lyn UTSW 4 3,783,055 (GRCm39) missense probably damaging 1.00
R9056:Lyn UTSW 4 3,780,925 (GRCm39) missense possibly damaging 0.89
R9353:Lyn UTSW 4 3,746,804 (GRCm39) missense possibly damaging 0.71
R9567:Lyn UTSW 4 3,746,757 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCATTTACAGGTGGGAAGCACAG -3'
(R):5'- TGTCACACAGCCAAACGTCTTAAGTAG -3'

Sequencing Primer
(F):5'- TGGGAAGCACAGAGCTTCAC -3'
(R):5'- ACGTCTTAAGTAGCATTTTGGC -3'
Posted On 2013-07-11