Incidental Mutation 'R0582:Lyn'
ID56457
Institutional Source Beutler Lab
Gene Symbol Lyn
Ensembl Gene ENSMUSG00000042228
Gene NameLYN proto-oncogene, Src family tyrosine kinase
SynonymsHck-2
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0582 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3678115-3813122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3743296 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 72 (L72Q)
Ref Sequence ENSEMBL: ENSMUSP00000100075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]
Predicted Effect probably damaging
Transcript: ENSMUST00000041377
AA Change: L93Q

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: L93Q

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103010
AA Change: L72Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: L72Q

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145083
Meta Mutation Damage Score 0.6605 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Lyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3743286 missense probably benign
IGL02744:Lyn APN 4 3738808 missense probably benign 0.00
IGL02860:Lyn APN 4 3745594 missense possibly damaging 0.77
IGL03328:Lyn APN 4 3745327 missense probably benign 0.01
IGL03370:Lyn APN 4 3780931 missense possibly damaging 0.81
Cress UTSW 4 3789908 nonsense probably null
Friede UTSW 4 3789834 nonsense probably null
Lemon UTSW 4 3746768 missense probably damaging 1.00
Pacific UTSW 4 3745330 missense probably damaging 1.00
water UTSW 4 3748787 missense possibly damaging 0.93
R0079:Lyn UTSW 4 3746768 missense probably damaging 1.00
R0089:Lyn UTSW 4 3748768 missense probably benign 0.23
R0747:Lyn UTSW 4 3745638 splice site probably benign
R1460:Lyn UTSW 4 3789908 nonsense probably null
R1615:Lyn UTSW 4 3748765 missense probably benign 0.11
R1654:Lyn UTSW 4 3789912 missense probably damaging 0.99
R1703:Lyn UTSW 4 3738867 splice site probably null
R2301:Lyn UTSW 4 3780959 missense probably damaging 1.00
R2421:Lyn UTSW 4 3748787 missense possibly damaging 0.93
R2512:Lyn UTSW 4 3745542 missense probably benign 0.01
R3418:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3419:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3701:Lyn UTSW 4 3742455 missense probably benign
R3702:Lyn UTSW 4 3742455 missense probably benign
R3736:Lyn UTSW 4 3745330 missense probably damaging 1.00
R4350:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4351:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4352:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4649:Lyn UTSW 4 3738850 missense probably benign
R5738:Lyn UTSW 4 3782987 missense probably damaging 1.00
R5875:Lyn UTSW 4 3745631 splice site probably null
R6375:Lyn UTSW 4 3745527 missense probably damaging 1.00
R7029:Lyn UTSW 4 3782996 missense probably damaging 0.98
R7621:Lyn UTSW 4 3789834 nonsense probably null
R7726:Lyn UTSW 4 3756428 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCATTTACAGGTGGGAAGCACAG -3'
(R):5'- TGTCACACAGCCAAACGTCTTAAGTAG -3'

Sequencing Primer
(F):5'- TGGGAAGCACAGAGCTTCAC -3'
(R):5'- ACGTCTTAAGTAGCATTTTGGC -3'
Posted On2013-07-11