Mutagenetix > Incidental Mutation

Incidental Mutation 'R7260:Vmn2r111'

564576

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7260 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (78/80)

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	G	10: 28,973,886	S293P	probably benign	Het
Actn2	T	C	13: 12,276,490	N676S	probably benign	Het
Amfr	C	T	8: 93,976,148	M463I	possibly damaging	Het
Ankdd1a	G	T	9: 65,504,552	A325D	probably damaging	Het
Apba2	A	G	7: 64,739,745	D463G	probably damaging	Het
Arid5b	A	G	10: 68,097,807	V755A	probably damaging	Het
Boc	A	T	16: 44,490,170	F796I		Het
Ccnt1	G	A	15: 98,565,124	Q56*	probably null	Het
Cd248	T	A	19: 5,069,355	Y410*	probably null	Het
Chd9	T	A	8: 90,994,543	N986K	unknown	Het
Col6a6	T	C	9: 105,783,969	T314A	probably benign	Het
Cpped1	A	G	16: 11,828,463	F142L	possibly damaging	Het
Csmd1	C	T	8: 16,000,574	A2221T	probably damaging	Het
Cyp2c69	C	A	19: 39,842,900	V490L	probably benign	Het
Dcst2	T	C	3: 89,366,286	F157S	probably damaging	Het
Ddx54	G	T	5: 120,626,920	R788L	probably benign	Het
Dnah1	T	C	14: 31,269,386	Y3145C	probably damaging	Het
Dnah14	A	T	1: 181,706,744	R2320W	probably damaging	Het
E130309D02Rik	A	G	5: 143,311,839	V151A	probably benign	Het
Emilin2	T	C	17: 71,274,790	T314A	probably benign	Het
Eml2	A	G	7: 19,200,590	S405G	probably benign	Het
Ephb2	A	G	4: 136,771,574	F65L	probably damaging	Het
Fam49b	A	T	15: 63,957,589	F23L	possibly damaging	Het
Fbn2	T	C	18: 58,066,116	D1360G	probably benign	Het
Fbxo22	A	G	9: 55,218,470	T206A	probably benign	Het
Filip1l	A	G	16: 57,570,924	E625G	probably damaging	Het
Gen1	A	C	12: 11,256,848	M172R	probably damaging	Het
Gk5	A	G	9: 96,119,610	K54E	probably benign	Het
Glis3	T	C	19: 28,531,402	E394G	probably benign	Het
Gm16486	T	C	8: 70,708,748	Y197H	probably benign	Het
Helq	T	A	5: 100,791,927	E373D	probably damaging	Het
Ighv1-74	A	G	12: 115,802,752	F83L	probably benign	Het
Kdm4d	T	C	9: 14,463,158	D468G	probably benign	Het
Kif20b	A	G	19: 34,950,210	I957M	probably damaging	Het
Ldhal6b	A	G	17: 5,418,260	F133S	possibly damaging	Het
Loxhd1	T	C	18: 77,332,642	Y321H	possibly damaging	Het
Ltbp1	A	T	17: 75,066,144	M261L	probably benign	Het
Mical2	A	T	7: 112,319,794	Q430L	probably benign	Het
Mroh4	A	T	15: 74,608,129	N885K	possibly damaging	Het
Ms4a7	A	G	19: 11,322,346	Y231H	probably damaging	Het
Msh2	G	T	17: 87,717,619	V642F	probably damaging	Het
Muc5b	G	T	7: 141,842,648	A166S	unknown	Het
Myo18b	T	C	5: 112,775,288	I1868V	probably benign	Het
Nfatc3	T	C	8: 106,108,946	S975P	probably benign	Het
Oacyl	T	C	18: 65,698,367	L25P	probably damaging	Het
Olfr1138	T	C	2: 87,738,508		probably null	Het
Olfr1145	A	G	2: 87,810,387	N189S	probably damaging	Het
Olfr1463	T	C	19: 13,235,024	F258S	probably damaging	Het
Olfr151	T	A	9: 37,730,753	I77F	probably damaging	Het
Olfr816	T	A	10: 129,912,287		probably benign	Het
Patj	A	G	4: 98,416,733	I275V	possibly damaging	Het
Pdcd11	G	A	19: 47,129,234	R1674Q	possibly damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Phkb	T	A	8: 85,878,130	Y55N	probably benign	Het
Pias4	A	G	10: 81,157,468	V207A	possibly damaging	Het
Plxna4	C	A	6: 32,239,520	R540L	possibly damaging	Het
Psapl1	G	A	5: 36,205,212	V383M	probably benign	Het
Rars	C	A	11: 35,834,454	A10S	probably benign	Het
Rhobtb1	A	T	10: 69,270,780	K454*	probably null	Het
Rmnd1	A	T	10: 4,414,803		probably null	Het
Rnf213	A	G	11: 119,452,575	I3589V		Het
Rngtt	T	C	4: 33,356,176	S338P	possibly damaging	Het
Sh3bgr	A	G	16: 96,224,481	E189G	unknown	Het
Slc30a3	G	A	5: 31,088,346	T281I	probably damaging	Het
Smok3c	T	A	5: 138,065,623	D457E	possibly damaging	Het
Stard9	C	A	2: 120,706,938	Q4274K	possibly damaging	Het
Syne2	G	T	12: 75,945,079	L1938F	probably damaging	Het
Tmem70	C	A	1: 16,665,366	T20K	possibly damaging	Het
Tnrc6a	A	G	7: 123,186,590	E1502G	probably benign	Het
Tpp1	A	T	7: 105,747,497	S438T	probably benign	Het
Tubb2a	T	A	13: 34,075,414	Q131L	probably damaging	Het
Ube2v1	A	G	2: 167,629,194	S26P	probably benign	Het
Unc13a	G	T	8: 71,660,585	S207R	possibly damaging	Het
Usp35	T	G	7: 97,320,079	D362A	probably damaging	Het
Utp20	A	G	10: 88,751,472	I2487T	probably benign	Het
Vmn2r117	T	A	17: 23,475,385	H496L	probably benign	Het
Vmn2r92	C	T	17: 18,166,876	A159V	probably damaging	Het
Wdr63	T	A	3: 146,046,540	M794L	probably benign	Het
Wiz	T	C	17: 32,359,111	K467E	probably damaging	Het
Zfp534	T	C	4: 147,675,004	T403A	probably benign	Het
Zswim5	T	C	4: 116,962,646	L416P	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCAAGGTGTAAAAGATGCAGCCC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- GGTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'

Posted On

2019-06-26