Incidental Mutation 'R7260:Msh2'
ID564581
Institutional Source Beutler Lab
Gene Symbol Msh2
Ensembl Gene ENSMUSG00000024151
Gene NamemutS homolog 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R7260 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location87672330-87723713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87717619 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 642 (V642F)
Ref Sequence ENSEMBL: ENSMUSP00000024967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024967]
Predicted Effect probably damaging
Transcript: ENSMUST00000024967
AA Change: V642F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: V642F

DomainStartEndE-ValueType
Pfam:MutS_I 17 132 4.6e-22 PFAM
Pfam:MutS_II 150 290 6.7e-23 PFAM
MUTSd 321 645 1e-105 SMART
MUTSac 662 849 3.54e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174703
SMART Domains Protein: ENSMUSP00000133488
Gene: ENSMUSG00000024151

DomainStartEndE-ValueType
Blast:MUTSd 2 63 7e-37 BLAST
PDB:2O8E|A 2 63 4e-32 PDB
SCOP:d1e3ma1 5 53 2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,973,886 S293P probably benign Het
Actn2 T C 13: 12,276,490 N676S probably benign Het
Amfr C T 8: 93,976,148 M463I possibly damaging Het
Ankdd1a G T 9: 65,504,552 A325D probably damaging Het
Apba2 A G 7: 64,739,745 D463G probably damaging Het
Arid5b A G 10: 68,097,807 V755A probably damaging Het
Boc A T 16: 44,490,170 F796I Het
Ccnt1 G A 15: 98,565,124 Q56* probably null Het
Cd248 T A 19: 5,069,355 Y410* probably null Het
Chd9 T A 8: 90,994,543 N986K unknown Het
Col6a6 T C 9: 105,783,969 T314A probably benign Het
Cpped1 A G 16: 11,828,463 F142L possibly damaging Het
Csmd1 C T 8: 16,000,574 A2221T probably damaging Het
Cyp2c69 C A 19: 39,842,900 V490L probably benign Het
Dcst2 T C 3: 89,366,286 F157S probably damaging Het
Ddx54 G T 5: 120,626,920 R788L probably benign Het
Dnah1 T C 14: 31,269,386 Y3145C probably damaging Het
Dnah14 A T 1: 181,706,744 R2320W probably damaging Het
E130309D02Rik A G 5: 143,311,839 V151A probably benign Het
Emilin2 T C 17: 71,274,790 T314A probably benign Het
Eml2 A G 7: 19,200,590 S405G probably benign Het
Ephb2 A G 4: 136,771,574 F65L probably damaging Het
Fam49b A T 15: 63,957,589 F23L possibly damaging Het
Fbn2 T C 18: 58,066,116 D1360G probably benign Het
Fbxo22 A G 9: 55,218,470 T206A probably benign Het
Filip1l A G 16: 57,570,924 E625G probably damaging Het
Gen1 A C 12: 11,256,848 M172R probably damaging Het
Gk5 A G 9: 96,119,610 K54E probably benign Het
Glis3 T C 19: 28,531,402 E394G probably benign Het
Gm16486 T C 8: 70,708,748 Y197H probably benign Het
Helq T A 5: 100,791,927 E373D probably damaging Het
Ighv1-74 A G 12: 115,802,752 F83L probably benign Het
Kdm4d T C 9: 14,463,158 D468G probably benign Het
Kif20b A G 19: 34,950,210 I957M probably damaging Het
Ldhal6b A G 17: 5,418,260 F133S possibly damaging Het
Loxhd1 T C 18: 77,332,642 Y321H possibly damaging Het
Ltbp1 A T 17: 75,066,144 M261L probably benign Het
Mical2 A T 7: 112,319,794 Q430L probably benign Het
Mroh4 A T 15: 74,608,129 N885K possibly damaging Het
Ms4a7 A G 19: 11,322,346 Y231H probably damaging Het
Muc5b G T 7: 141,842,648 A166S unknown Het
Myo18b T C 5: 112,775,288 I1868V probably benign Het
Nfatc3 T C 8: 106,108,946 S975P probably benign Het
Oacyl T C 18: 65,698,367 L25P probably damaging Het
Olfr1138 T C 2: 87,738,508 probably null Het
Olfr1145 A G 2: 87,810,387 N189S probably damaging Het
Olfr1463 T C 19: 13,235,024 F258S probably damaging Het
Olfr151 T A 9: 37,730,753 I77F probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Patj A G 4: 98,416,733 I275V possibly damaging Het
Pdcd11 G A 19: 47,129,234 R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phkb T A 8: 85,878,130 Y55N probably benign Het
Pias4 A G 10: 81,157,468 V207A possibly damaging Het
Plxna4 C A 6: 32,239,520 R540L possibly damaging Het
Psapl1 G A 5: 36,205,212 V383M probably benign Het
Rars C A 11: 35,834,454 A10S probably benign Het
Rhobtb1 A T 10: 69,270,780 K454* probably null Het
Rmnd1 A T 10: 4,414,803 probably null Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rngtt T C 4: 33,356,176 S338P possibly damaging Het
Sh3bgr A G 16: 96,224,481 E189G unknown Het
Slc30a3 G A 5: 31,088,346 T281I probably damaging Het
Smok3c T A 5: 138,065,623 D457E possibly damaging Het
Stard9 C A 2: 120,706,938 Q4274K possibly damaging Het
Syne2 G T 12: 75,945,079 L1938F probably damaging Het
Tmem70 C A 1: 16,665,366 T20K possibly damaging Het
Tnrc6a A G 7: 123,186,590 E1502G probably benign Het
Tpp1 A T 7: 105,747,497 S438T probably benign Het
Tubb2a T A 13: 34,075,414 Q131L probably damaging Het
Ube2v1 A G 2: 167,629,194 S26P probably benign Het
Unc13a G T 8: 71,660,585 S207R possibly damaging Het
Usp35 T G 7: 97,320,079 D362A probably damaging Het
Utp20 A G 10: 88,751,472 I2487T probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r117 T A 17: 23,475,385 H496L probably benign Het
Vmn2r92 C T 17: 18,166,876 A159V probably damaging Het
Wdr63 T A 3: 146,046,540 M794L probably benign Het
Wiz T C 17: 32,359,111 K467E probably damaging Het
Zfp534 T C 4: 147,675,004 T403A probably benign Het
Zswim5 T C 4: 116,962,646 L416P probably damaging Het
Other mutations in Msh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Msh2 APN 17 87678235 missense probably damaging 1.00
IGL01602:Msh2 APN 17 87696489 unclassified probably benign
IGL01605:Msh2 APN 17 87696489 unclassified probably benign
IGL01775:Msh2 APN 17 87682646 missense possibly damaging 0.94
IGL02243:Msh2 APN 17 87678368 splice site probably benign
IGL02524:Msh2 APN 17 87678357 missense probably benign 0.01
IGL02730:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL02743:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL03049:Msh2 APN 17 87708509 missense probably damaging 1.00
IGL03282:Msh2 APN 17 87689002 missense probably benign 0.00
IGL03286:Msh2 APN 17 87682667 missense possibly damaging 0.92
R0011:Msh2 UTSW 17 87680093 intron probably benign
R0363:Msh2 UTSW 17 87717476 missense probably benign 0.30
R0520:Msh2 UTSW 17 87717544 missense possibly damaging 0.77
R0633:Msh2 UTSW 17 87672810 splice site probably null
R0862:Msh2 UTSW 17 87680052 missense probably benign
R0864:Msh2 UTSW 17 87680052 missense probably benign
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1264:Msh2 UTSW 17 87707179 splice site probably null
R1459:Msh2 UTSW 17 87678343 missense probably benign 0.01
R1572:Msh2 UTSW 17 87718652 missense possibly damaging 0.89
R1592:Msh2 UTSW 17 87680013 intron probably null
R1647:Msh2 UTSW 17 87672636 missense probably benign
R1984:Msh2 UTSW 17 87719296 missense probably damaging 1.00
R2298:Msh2 UTSW 17 87708502 missense probably damaging 0.99
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R4383:Msh2 UTSW 17 87689138 missense probably benign 0.00
R4411:Msh2 UTSW 17 87717604 missense probably damaging 0.97
R4589:Msh2 UTSW 17 87680032 missense possibly damaging 0.67
R4598:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4599:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4712:Msh2 UTSW 17 87678385 intron probably benign
R4714:Msh2 UTSW 17 87718789 missense probably damaging 1.00
R4834:Msh2 UTSW 17 87723413 missense probably benign
R4842:Msh2 UTSW 17 87723413 missense probably benign
R4859:Msh2 UTSW 17 87718759 missense possibly damaging 0.94
R5007:Msh2 UTSW 17 87723413 missense probably benign
R5008:Msh2 UTSW 17 87723413 missense probably benign
R5010:Msh2 UTSW 17 87723413 missense probably benign
R5014:Msh2 UTSW 17 87717576 missense possibly damaging 0.83
R5048:Msh2 UTSW 17 87672768 missense probably damaging 1.00
R5133:Msh2 UTSW 17 87723413 missense probably benign
R5162:Msh2 UTSW 17 87723413 missense probably benign
R5163:Msh2 UTSW 17 87723413 missense probably benign
R5183:Msh2 UTSW 17 87723413 missense probably benign
R5184:Msh2 UTSW 17 87723413 missense probably benign
R5597:Msh2 UTSW 17 87723361 missense probably benign 0.04
R5655:Msh2 UTSW 17 87719443 missense possibly damaging 0.82
R5973:Msh2 UTSW 17 87708583 missense probably damaging 1.00
R6191:Msh2 UTSW 17 87723472 missense probably benign 0.03
R6632:Msh2 UTSW 17 87712666 missense possibly damaging 0.49
R7358:Msh2 UTSW 17 87717529 missense possibly damaging 0.89
X0058:Msh2 UTSW 17 87679934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGCCTTGAGCTAAGTC -3'
(R):5'- TCTGAATGTATGACCAACCAGAG -3'

Sequencing Primer
(F):5'- CGGCCTTGAGCTAAGTCTATTATAAG -3'
(R):5'- GAATGTATGACCAACCAGAGTAATAC -3'
Posted On2019-06-26