Incidental Mutation 'R7260:Olfr1463'
ID564587
Institutional Source Beutler Lab
Gene Symbol Olfr1463
Ensembl Gene ENSMUSG00000096365
Gene Nameolfactory receptor 1463
SynonymsMOR202-29P, GA_x6K02T2RE5P-3560863-3561795
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7260 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13231328-13236400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13235024 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 258 (F258S)
Ref Sequence ENSEMBL: ENSMUSP00000146566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064102] [ENSMUST00000207246]
Predicted Effect probably damaging
Transcript: ENSMUST00000064102
AA Change: F258S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070872
Gene: ENSMUSG00000096365
AA Change: F258S

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3.2e-6 PFAM
Pfam:7tm_1 42 291 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207246
AA Change: F258S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.3782 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (78/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,973,886 S293P probably benign Het
Actn2 T C 13: 12,276,490 N676S probably benign Het
Amfr C T 8: 93,976,148 M463I possibly damaging Het
Ankdd1a G T 9: 65,504,552 A325D probably damaging Het
Apba2 A G 7: 64,739,745 D463G probably damaging Het
Arid5b A G 10: 68,097,807 V755A probably damaging Het
Boc A T 16: 44,490,170 F796I Het
Ccnt1 G A 15: 98,565,124 Q56* probably null Het
Cd248 T A 19: 5,069,355 Y410* probably null Het
Chd9 T A 8: 90,994,543 N986K unknown Het
Col6a6 T C 9: 105,783,969 T314A probably benign Het
Cpped1 A G 16: 11,828,463 F142L possibly damaging Het
Csmd1 C T 8: 16,000,574 A2221T probably damaging Het
Cyp2c69 C A 19: 39,842,900 V490L probably benign Het
Dcst2 T C 3: 89,366,286 F157S probably damaging Het
Ddx54 G T 5: 120,626,920 R788L probably benign Het
Dnah1 T C 14: 31,269,386 Y3145C probably damaging Het
Dnah14 A T 1: 181,706,744 R2320W probably damaging Het
E130309D02Rik A G 5: 143,311,839 V151A probably benign Het
Emilin2 T C 17: 71,274,790 T314A probably benign Het
Eml2 A G 7: 19,200,590 S405G probably benign Het
Ephb2 A G 4: 136,771,574 F65L probably damaging Het
Fam49b A T 15: 63,957,589 F23L possibly damaging Het
Fbn2 T C 18: 58,066,116 D1360G probably benign Het
Fbxo22 A G 9: 55,218,470 T206A probably benign Het
Filip1l A G 16: 57,570,924 E625G probably damaging Het
Gen1 A C 12: 11,256,848 M172R probably damaging Het
Gk5 A G 9: 96,119,610 K54E probably benign Het
Glis3 T C 19: 28,531,402 E394G probably benign Het
Gm16486 T C 8: 70,708,748 Y197H probably benign Het
Helq T A 5: 100,791,927 E373D probably damaging Het
Ighv1-74 A G 12: 115,802,752 F83L probably benign Het
Kdm4d T C 9: 14,463,158 D468G probably benign Het
Kif20b A G 19: 34,950,210 I957M probably damaging Het
Ldhal6b A G 17: 5,418,260 F133S possibly damaging Het
Loxhd1 T C 18: 77,332,642 Y321H possibly damaging Het
Ltbp1 A T 17: 75,066,144 M261L probably benign Het
Mical2 A T 7: 112,319,794 Q430L probably benign Het
Mroh4 A T 15: 74,608,129 N885K possibly damaging Het
Ms4a7 A G 19: 11,322,346 Y231H probably damaging Het
Msh2 G T 17: 87,717,619 V642F probably damaging Het
Muc5b G T 7: 141,842,648 A166S unknown Het
Myo18b T C 5: 112,775,288 I1868V probably benign Het
Nfatc3 T C 8: 106,108,946 S975P probably benign Het
Oacyl T C 18: 65,698,367 L25P probably damaging Het
Olfr1138 T C 2: 87,738,508 probably null Het
Olfr1145 A G 2: 87,810,387 N189S probably damaging Het
Olfr151 T A 9: 37,730,753 I77F probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Patj A G 4: 98,416,733 I275V possibly damaging Het
Pdcd11 G A 19: 47,129,234 R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phkb T A 8: 85,878,130 Y55N probably benign Het
Pias4 A G 10: 81,157,468 V207A possibly damaging Het
Plxna4 C A 6: 32,239,520 R540L possibly damaging Het
Psapl1 G A 5: 36,205,212 V383M probably benign Het
Rars C A 11: 35,834,454 A10S probably benign Het
Rhobtb1 A T 10: 69,270,780 K454* probably null Het
Rmnd1 A T 10: 4,414,803 probably null Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rngtt T C 4: 33,356,176 S338P possibly damaging Het
Sh3bgr A G 16: 96,224,481 E189G unknown Het
Slc30a3 G A 5: 31,088,346 T281I probably damaging Het
Smok3c T A 5: 138,065,623 D457E possibly damaging Het
Stard9 C A 2: 120,706,938 Q4274K possibly damaging Het
Syne2 G T 12: 75,945,079 L1938F probably damaging Het
Tmem70 C A 1: 16,665,366 T20K possibly damaging Het
Tnrc6a A G 7: 123,186,590 E1502G probably benign Het
Tpp1 A T 7: 105,747,497 S438T probably benign Het
Tubb2a T A 13: 34,075,414 Q131L probably damaging Het
Ube2v1 A G 2: 167,629,194 S26P probably benign Het
Unc13a G T 8: 71,660,585 S207R possibly damaging Het
Usp35 T G 7: 97,320,079 D362A probably damaging Het
Utp20 A G 10: 88,751,472 I2487T probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r117 T A 17: 23,475,385 H496L probably benign Het
Vmn2r92 C T 17: 18,166,876 A159V probably damaging Het
Wdr63 T A 3: 146,046,540 M794L probably benign Het
Wiz T C 17: 32,359,111 K467E probably damaging Het
Zfp534 T C 4: 147,675,004 T403A probably benign Het
Zswim5 T C 4: 116,962,646 L416P probably damaging Het
Other mutations in Olfr1463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Olfr1463 APN 19 13234739 missense probably benign 0.01
IGL02596:Olfr1463 APN 19 13234399 missense probably damaging 1.00
IGL03030:Olfr1463 APN 19 13235054 missense probably damaging 0.98
IGL03232:Olfr1463 APN 19 13234977 nonsense probably null
IGL03380:Olfr1463 APN 19 13235001 missense probably benign 0.00
PIT4382001:Olfr1463 UTSW 19 13234895 missense probably damaging 1.00
PIT4519001:Olfr1463 UTSW 19 13234852 missense probably benign 0.00
R0652:Olfr1463 UTSW 19 13234535 missense possibly damaging 0.80
R0658:Olfr1463 UTSW 19 13235060 missense possibly damaging 0.94
R1181:Olfr1463 UTSW 19 13234831 missense probably benign 0.07
R1239:Olfr1463 UTSW 19 13234676 missense possibly damaging 0.80
R1316:Olfr1463 UTSW 19 13234439 missense probably damaging 1.00
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1900:Olfr1463 UTSW 19 13234913 missense possibly damaging 0.54
R1927:Olfr1463 UTSW 19 13235029 missense probably damaging 1.00
R2239:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R2380:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R3760:Olfr1463 UTSW 19 13234886 missense probably damaging 1.00
R3765:Olfr1463 UTSW 19 13234431 missense probably damaging 1.00
R3835:Olfr1463 UTSW 19 13234739 missense probably benign 0.18
R4690:Olfr1463 UTSW 19 13234768 missense possibly damaging 0.91
R4907:Olfr1463 UTSW 19 13234793 missense probably damaging 1.00
R5444:Olfr1463 UTSW 19 13234958 missense probably benign 0.28
R5465:Olfr1463 UTSW 19 13234688 missense probably benign 0.00
R6083:Olfr1463 UTSW 19 13234525 missense probably benign 0.01
R6259:Olfr1463 UTSW 19 13234421 missense probably damaging 0.98
R6324:Olfr1463 UTSW 19 13235104 missense possibly damaging 0.95
R6561:Olfr1463 UTSW 19 13235030 missense probably damaging 1.00
R6845:Olfr1463 UTSW 19 13234633 missense probably damaging 1.00
R7843:Olfr1463 UTSW 19 13234537 missense possibly damaging 0.48
X0063:Olfr1463 UTSW 19 13234635 missense probably damaging 1.00
X0067:Olfr1463 UTSW 19 13234697 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGGATAGGCATATCAATGAGCTAG -3'
(R):5'- GGCAAGAATAAGAACTCACATCATG -3'

Sequencing Primer
(F):5'- AGCTAGTACTTATTTATCTAGCCAGC -3'
(R):5'- TTAATATTATGGAGAATGCCAGGGCC -3'
Posted On2019-06-26