Incidental Mutation 'R7260:Kif20b'
ID564589
Institutional Source Beutler Lab
Gene Symbol Kif20b
Ensembl Gene ENSMUSG00000024795
Gene Namekinesin family member 20B
SynonymsKif20b, Mphosph1, N-6 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R7260 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34922361-34975745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34950210 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 957 (I957M)
Ref Sequence ENSEMBL: ENSMUSP00000084599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087341] [ENSMUST00000223907] [ENSMUST00000223937]
Predicted Effect probably damaging
Transcript: ENSMUST00000087341
AA Change: I957M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084599
Gene: ENSMUSG00000024795
AA Change: I957M

DomainStartEndE-ValueType
Blast:KISc 2 46 5e-15 BLAST
KISc 56 483 1.19e-103 SMART
low complexity region 521 551 N/A INTRINSIC
coiled coil region 565 602 N/A INTRINSIC
coiled coil region 705 746 N/A INTRINSIC
coiled coil region 823 947 N/A INTRINSIC
coiled coil region 1020 1325 N/A INTRINSIC
coiled coil region 1348 1510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223907
AA Change: I917M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000223937
Predicted Effect probably benign
Transcript: ENSMUST00000224728
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (78/80)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU induced mutations display craniofacial and nervous system abnormalities including exencephaly, microcephaly, decreased forebrain size and impaired neuronal progenitor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,973,886 S293P probably benign Het
Actn2 T C 13: 12,276,490 N676S probably benign Het
Amfr C T 8: 93,976,148 M463I possibly damaging Het
Ankdd1a G T 9: 65,504,552 A325D probably damaging Het
Apba2 A G 7: 64,739,745 D463G probably damaging Het
Arid5b A G 10: 68,097,807 V755A probably damaging Het
Boc A T 16: 44,490,170 F796I Het
Ccnt1 G A 15: 98,565,124 Q56* probably null Het
Cd248 T A 19: 5,069,355 Y410* probably null Het
Chd9 T A 8: 90,994,543 N986K unknown Het
Col6a6 T C 9: 105,783,969 T314A probably benign Het
Cpped1 A G 16: 11,828,463 F142L possibly damaging Het
Csmd1 C T 8: 16,000,574 A2221T probably damaging Het
Cyp2c69 C A 19: 39,842,900 V490L probably benign Het
Dcst2 T C 3: 89,366,286 F157S probably damaging Het
Ddx54 G T 5: 120,626,920 R788L probably benign Het
Dnah1 T C 14: 31,269,386 Y3145C probably damaging Het
Dnah14 A T 1: 181,706,744 R2320W probably damaging Het
E130309D02Rik A G 5: 143,311,839 V151A probably benign Het
Emilin2 T C 17: 71,274,790 T314A probably benign Het
Eml2 A G 7: 19,200,590 S405G probably benign Het
Ephb2 A G 4: 136,771,574 F65L probably damaging Het
Fam49b A T 15: 63,957,589 F23L possibly damaging Het
Fbn2 T C 18: 58,066,116 D1360G probably benign Het
Fbxo22 A G 9: 55,218,470 T206A probably benign Het
Filip1l A G 16: 57,570,924 E625G probably damaging Het
Gen1 A C 12: 11,256,848 M172R probably damaging Het
Gk5 A G 9: 96,119,610 K54E probably benign Het
Glis3 T C 19: 28,531,402 E394G probably benign Het
Gm16486 T C 8: 70,708,748 Y197H probably benign Het
Helq T A 5: 100,791,927 E373D probably damaging Het
Ighv1-74 A G 12: 115,802,752 F83L probably benign Het
Kdm4d T C 9: 14,463,158 D468G probably benign Het
Ldhal6b A G 17: 5,418,260 F133S possibly damaging Het
Loxhd1 T C 18: 77,332,642 Y321H possibly damaging Het
Ltbp1 A T 17: 75,066,144 M261L probably benign Het
Mical2 A T 7: 112,319,794 Q430L probably benign Het
Mroh4 A T 15: 74,608,129 N885K possibly damaging Het
Ms4a7 A G 19: 11,322,346 Y231H probably damaging Het
Msh2 G T 17: 87,717,619 V642F probably damaging Het
Muc5b G T 7: 141,842,648 A166S unknown Het
Myo18b T C 5: 112,775,288 I1868V probably benign Het
Nfatc3 T C 8: 106,108,946 S975P probably benign Het
Oacyl T C 18: 65,698,367 L25P probably damaging Het
Olfr1138 T C 2: 87,738,508 probably null Het
Olfr1145 A G 2: 87,810,387 N189S probably damaging Het
Olfr1463 T C 19: 13,235,024 F258S probably damaging Het
Olfr151 T A 9: 37,730,753 I77F probably damaging Het
Olfr816 T A 10: 129,912,287 probably benign Het
Patj A G 4: 98,416,733 I275V possibly damaging Het
Pdcd11 G A 19: 47,129,234 R1674Q possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Phkb T A 8: 85,878,130 Y55N probably benign Het
Pias4 A G 10: 81,157,468 V207A possibly damaging Het
Plxna4 C A 6: 32,239,520 R540L possibly damaging Het
Psapl1 G A 5: 36,205,212 V383M probably benign Het
Rars C A 11: 35,834,454 A10S probably benign Het
Rhobtb1 A T 10: 69,270,780 K454* probably null Het
Rmnd1 A T 10: 4,414,803 probably null Het
Rnf213 A G 11: 119,452,575 I3589V Het
Rngtt T C 4: 33,356,176 S338P possibly damaging Het
Sh3bgr A G 16: 96,224,481 E189G unknown Het
Slc30a3 G A 5: 31,088,346 T281I probably damaging Het
Smok3c T A 5: 138,065,623 D457E possibly damaging Het
Stard9 C A 2: 120,706,938 Q4274K possibly damaging Het
Syne2 G T 12: 75,945,079 L1938F probably damaging Het
Tmem70 C A 1: 16,665,366 T20K possibly damaging Het
Tnrc6a A G 7: 123,186,590 E1502G probably benign Het
Tpp1 A T 7: 105,747,497 S438T probably benign Het
Tubb2a T A 13: 34,075,414 Q131L probably damaging Het
Ube2v1 A G 2: 167,629,194 S26P probably benign Het
Unc13a G T 8: 71,660,585 S207R possibly damaging Het
Usp35 T G 7: 97,320,079 D362A probably damaging Het
Utp20 A G 10: 88,751,472 I2487T probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vmn2r117 T A 17: 23,475,385 H496L probably benign Het
Vmn2r92 C T 17: 18,166,876 A159V probably damaging Het
Wdr63 T A 3: 146,046,540 M794L probably benign Het
Wiz T C 17: 32,359,111 K467E probably damaging Het
Zfp534 T C 4: 147,675,004 T403A probably benign Het
Zswim5 T C 4: 116,962,646 L416P probably damaging Het
Other mutations in Kif20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kif20b APN 19 34947660 missense possibly damaging 0.77
IGL01021:Kif20b APN 19 34938260 missense possibly damaging 0.89
IGL01590:Kif20b APN 19 34954726 missense possibly damaging 0.87
IGL01691:Kif20b APN 19 34935743 splice site probably benign
IGL01730:Kif20b APN 19 34950523 nonsense probably null
IGL02078:Kif20b APN 19 34935644 missense probably damaging 1.00
IGL02174:Kif20b APN 19 34934458 splice site probably benign
IGL02536:Kif20b APN 19 34974559 missense probably benign 0.42
IGL03029:Kif20b APN 19 34950913 missense probably benign
IGL03186:Kif20b APN 19 34934944 missense probably benign 0.45
IGL03205:Kif20b APN 19 34959463 missense probably damaging 1.00
IGL03493:Kif20b APN 19 34959550 nonsense probably null
R0319:Kif20b UTSW 19 34947732 splice site probably benign
R1069:Kif20b UTSW 19 34950851 missense probably damaging 1.00
R1137:Kif20b UTSW 19 34937086 critical splice donor site probably null
R1255:Kif20b UTSW 19 34950106 missense probably benign 0.08
R1352:Kif20b UTSW 19 34924635 missense probably benign
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1466:Kif20b UTSW 19 34950599 missense probably benign 0.00
R1473:Kif20b UTSW 19 34974496 missense possibly damaging 0.93
R1545:Kif20b UTSW 19 34928918 missense probably damaging 1.00
R1647:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1648:Kif20b UTSW 19 34936790 missense possibly damaging 0.65
R1752:Kif20b UTSW 19 34938336 missense probably benign 0.13
R1835:Kif20b UTSW 19 34956038 missense probably damaging 1.00
R1889:Kif20b UTSW 19 34941208 unclassified probably benign
R1937:Kif20b UTSW 19 34952878 missense possibly damaging 0.73
R2112:Kif20b UTSW 19 34931732 missense probably benign 0.04
R2315:Kif20b UTSW 19 34931599 missense probably damaging 1.00
R2385:Kif20b UTSW 19 34959419 missense probably damaging 0.98
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R2867:Kif20b UTSW 19 34940128 missense probably damaging 1.00
R3086:Kif20b UTSW 19 34929715 missense probably damaging 1.00
R3116:Kif20b UTSW 19 34970080 missense probably benign 0.38
R3407:Kif20b UTSW 19 34950500 missense probably damaging 1.00
R3834:Kif20b UTSW 19 34935028 missense probably damaging 1.00
R3882:Kif20b UTSW 19 34950080 missense probably damaging 1.00
R4698:Kif20b UTSW 19 34951544 missense probably damaging 1.00
R4721:Kif20b UTSW 19 34938373 missense probably benign 0.41
R4883:Kif20b UTSW 19 34966122 missense probably benign 0.00
R4901:Kif20b UTSW 19 34934436 missense probably benign 0.00
R4923:Kif20b UTSW 19 34941211 critical splice acceptor site probably null
R5538:Kif20b UTSW 19 34952964 nonsense probably null
R5540:Kif20b UTSW 19 34938460 missense probably benign 0.01
R5558:Kif20b UTSW 19 34951549 missense probably damaging 1.00
R5580:Kif20b UTSW 19 34949728 splice site probably null
R5934:Kif20b UTSW 19 34941321 missense probably benign 0.02
R6019:Kif20b UTSW 19 34950464 missense probably benign 0.00
R6464:Kif20b UTSW 19 34934441 missense probably benign
R6613:Kif20b UTSW 19 34936984 nonsense probably null
R6745:Kif20b UTSW 19 34928876 missense possibly damaging 0.94
R7097:Kif20b UTSW 19 34974492 missense probably damaging 0.98
R7237:Kif20b UTSW 19 34950605 missense probably damaging 1.00
R7373:Kif20b UTSW 19 34935671 missense probably damaging 1.00
R7418:Kif20b UTSW 19 34929687 missense probably damaging 0.99
Z1088:Kif20b UTSW 19 34950451 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCCAGTTACAACAGTGC -3'
(R):5'- GGAAGCCTTCACAATCTCTTTAC -3'

Sequencing Primer
(F):5'- CAACAGTGCAGTTGCCGAG -3'
(R):5'- ACATTCTTCCCAGATGGCTTCAATAC -3'
Posted On2019-06-26