Incidental Mutation 'R7261:Spag16'
ID564593
Institutional Source Beutler Lab
Gene Symbol Spag16
Ensembl Gene ENSMUSG00000053153
Gene Namesperm associated antigen 16
Synonyms4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R7261 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location69826970-70725132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70299621 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 426 (I426T)
Ref Sequence ENSEMBL: ENSMUSP00000069821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065425]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065425
AA Change: I426T

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: I426T

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
coiled coil region 146 190 N/A INTRINSIC
WD40 349 388 7.8e-2 SMART
WD40 391 430 6.23e-10 SMART
WD40 433 472 1.34e-9 SMART
WD40 475 514 1.92e-10 SMART
WD40 517 556 2.38e-6 SMART
WD40 559 598 1.42e2 SMART
WD40 600 639 4.83e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Chrng A T 1: 87,207,240 probably null Het
Cnksr1 T C 4: 134,235,773 probably null Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Map2k3 G A 11: 60,945,567 probably null Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ncor2 T C 5: 125,110,079 probably null Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Nme3 A G 17: 24,897,063 probably null Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Strbp A T 2: 37,641,137 probably null Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Spag16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Spag16 APN 1 70299650 missense probably damaging 1.00
IGL01129:Spag16 APN 1 69896522 missense probably benign 0.01
IGL02117:Spag16 APN 1 69870320 missense probably damaging 1.00
IGL02245:Spag16 APN 1 69858502 missense probably benign
IGL02492:Spag16 APN 1 69887529 missense probably benign
IGL02851:Spag16 APN 1 70264908 missense possibly damaging 0.76
IGL03271:Spag16 APN 1 69853352 missense probably benign 0.00
IGL03274:Spag16 APN 1 69844381 splice site probably benign
PIT4243001:Spag16 UTSW 1 69853381 missense probably damaging 1.00
R0084:Spag16 UTSW 1 69996839 missense probably benign 0.02
R0513:Spag16 UTSW 1 70493768 splice site probably benign
R0653:Spag16 UTSW 1 69870345 missense probably damaging 1.00
R1165:Spag16 UTSW 1 69996877 missense probably benign 0.04
R1178:Spag16 UTSW 1 69923658 splice site probably benign
R1180:Spag16 UTSW 1 69923658 splice site probably benign
R1404:Spag16 UTSW 1 69895280 splice site probably benign
R1547:Spag16 UTSW 1 69873243 missense possibly damaging 0.51
R1689:Spag16 UTSW 1 70461118 missense probably benign 0.01
R1699:Spag16 UTSW 1 69996856 missense probably benign 0.05
R1714:Spag16 UTSW 1 69843005 missense probably damaging 0.97
R1724:Spag16 UTSW 1 70493782 missense probably damaging 1.00
R1873:Spag16 UTSW 1 69896585 splice site probably benign
R2196:Spag16 UTSW 1 69858522 missense possibly damaging 0.92
R2207:Spag16 UTSW 1 70724884 missense probably benign 0.00
R4058:Spag16 UTSW 1 69853328 missense probably damaging 0.96
R4276:Spag16 UTSW 1 69873481 intron probably benign
R4497:Spag16 UTSW 1 70493830 missense probably damaging 1.00
R4560:Spag16 UTSW 1 69844296 missense probably benign 0.05
R4648:Spag16 UTSW 1 69827035 missense probably null 0.99
R4972:Spag16 UTSW 1 70724928 missense probably damaging 1.00
R5027:Spag16 UTSW 1 69923804 intron probably benign
R5032:Spag16 UTSW 1 69853352 missense probably benign 0.00
R5174:Spag16 UTSW 1 70493796 missense probably damaging 1.00
R5276:Spag16 UTSW 1 69896583 critical splice donor site probably null
R5537:Spag16 UTSW 1 69827016 missense probably benign
R5706:Spag16 UTSW 1 69870289 missense probably benign 0.01
R5834:Spag16 UTSW 1 69923714 missense probably benign 0.00
R6131:Spag16 UTSW 1 70725083 utr 3 prime probably null
R6246:Spag16 UTSW 1 69923821 missense probably benign 0.45
R7164:Spag16 UTSW 1 70724866 missense possibly damaging 0.88
R7298:Spag16 UTSW 1 69919426 intron probably null
R7358:Spag16 UTSW 1 69844367 missense probably benign 0.00
R7431:Spag16 UTSW 1 69923872 missense unknown
R7508:Spag16 UTSW 1 69887520 missense possibly damaging 0.93
R7566:Spag16 UTSW 1 69870328 missense probably damaging 1.00
R7570:Spag16 UTSW 1 69996841 missense probably benign 0.00
R7598:Spag16 UTSW 1 69870308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTAGCGGTTTATCTCAAAGC -3'
(R):5'- ACTCTATTCCCACAAATGTCTAGC -3'

Sequencing Primer
(F):5'- GCGGTTTATCTCAAAGCATGAATTC -3'
(R):5'- TGTCTAGCAGTATAAAAGAATGACG -3'
Posted On2019-06-26