Incidental Mutation 'R0582:Ipp'
ID56460
Institutional Source Beutler Lab
Gene Symbol Ipp
Ensembl Gene ENSMUSG00000028696
Gene NameIAP promoted placental gene
SynonymsD4Jhu8, Mipp
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0582 (G1)
Quality Score219
Status Validated
Chromosome4
Chromosomal Location116507549-116538243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116515467 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 231 (L231S)
Ref Sequence ENSEMBL: ENSMUSP00000102088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030461] [ENSMUST00000106479]
Predicted Effect probably damaging
Transcript: ENSMUST00000030461
AA Change: L231S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030461
Gene: ENSMUSG00000028696
AA Change: L231S

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106479
AA Change: L231S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102088
Gene: ENSMUSG00000028696
AA Change: L231S

DomainStartEndE-ValueType
BTB 37 134 5.37e-30 SMART
BACK 139 241 6.59e-29 SMART
Kelch 289 343 3.8e-9 SMART
Kelch 344 390 1.61e-12 SMART
Kelch 391 437 2.9e-14 SMART
Kelch 438 485 1.94e-15 SMART
Kelch 486 533 2.79e-16 SMART
Kelch 534 584 1.67e-5 SMART
Meta Mutation Damage Score 0.7488 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kelch family of proteins, which is characterized by a 50 amino acid repeat which interacts with actin. Transcript variants have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Ipp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ipp APN 4 116532659 missense possibly damaging 0.93
IGL01399:Ipp APN 4 116515187 missense probably damaging 1.00
IGL01934:Ipp APN 4 116510655 missense probably damaging 0.99
IGL02805:Ipp APN 4 116529688 missense possibly damaging 0.92
Iguacu UTSW 4 116537938 nonsense probably null
R0669:Ipp UTSW 4 116537876 missense probably damaging 1.00
R1121:Ipp UTSW 4 116520675 missense probably benign 0.00
R1394:Ipp UTSW 4 116537912 nonsense probably null
R1738:Ipp UTSW 4 116530421 missense probably benign 0.00
R2021:Ipp UTSW 4 116515368 missense probably benign 0.26
R3103:Ipp UTSW 4 116524249 missense possibly damaging 0.65
R4372:Ipp UTSW 4 116515363 missense possibly damaging 0.90
R4439:Ipp UTSW 4 116515077 missense probably benign 0.00
R4571:Ipp UTSW 4 116530458 missense probably damaging 1.00
R5134:Ipp UTSW 4 116515457 missense possibly damaging 0.65
R5503:Ipp UTSW 4 116537938 nonsense probably null
R5519:Ipp UTSW 4 116510767 missense possibly damaging 0.76
R5640:Ipp UTSW 4 116520689 missense possibly damaging 0.67
R5768:Ipp UTSW 4 116510770 missense probably damaging 1.00
R6867:Ipp UTSW 4 116510409 splice site probably null
R7575:Ipp UTSW 4 116532644 missense probably benign 0.20
R7851:Ipp UTSW 4 116515475 nonsense probably null
R7992:Ipp UTSW 4 116524256 missense probably damaging 1.00
R8069:Ipp UTSW 4 116510856 missense probably benign 0.11
Z1176:Ipp UTSW 4 116537885 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAGTTCCTCGGGCTTACAAAAG -3'
(R):5'- AGTCCCTCTGGTTGTGGTAGTACATAC -3'

Sequencing Primer
(F):5'- TTCCTCGGGCTTACAAAAGATCAG -3'
(R):5'- acacaaggggaggaacaac -3'
Posted On2013-07-11