Incidental Mutation 'R7261:Col15a1'
ID564605
Institutional Source Beutler Lab
Gene Symbol Col15a1
Ensembl Gene ENSMUSG00000028339
Gene Namecollagen, type XV, alpha 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7261 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location47208161-47313167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47269088 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 582 (G582D)
Ref Sequence ENSEMBL: ENSMUSP00000099981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082303] [ENSMUST00000102917]
PDB Structure
MURINE COLLAGEN ALPHA1(XV), ENDOSTATIN DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000082303
AA Change: G582D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000080921
Gene: ENSMUSG00000028339
AA Change: G582D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 663 1.4e-10 PFAM
Pfam:Collagen 650 719 2.1e-9 PFAM
low complexity region 722 742 N/A INTRINSIC
low complexity region 750 759 N/A INTRINSIC
Pfam:Collagen 782 832 2.7e-10 PFAM
Pfam:Collagen 838 894 5.1e-10 PFAM
low complexity region 965 980 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
Pfam:Endostatin 1087 1164 9.3e-15 PFAM
Pfam:Endostatin 1148 1345 1.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102917
AA Change: G582D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099981
Gene: ENSMUSG00000028339
AA Change: G582D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSPN 40 228 2.53e-56 SMART
LamG 89 227 1.7e-7 SMART
low complexity region 236 251 N/A INTRINSIC
low complexity region 332 344 N/A INTRINSIC
low complexity region 541 567 N/A INTRINSIC
Pfam:Collagen 603 666 5.6e-10 PFAM
Pfam:Collagen 659 720 3.1e-10 PFAM
low complexity region 737 764 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
Pfam:Collagen 804 854 9.5e-10 PFAM
Pfam:Collagen 860 916 1.8e-9 PFAM
low complexity region 987 1002 N/A INTRINSIC
low complexity region 1032 1042 N/A INTRINSIC
low complexity region 1050 1109 N/A INTRINSIC
Pfam:Endostatin 1112 1362 2.8e-102 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. The proteolytically produced C-terminal fragment of type XV collagen is restin, a potentially antiangiogenic protein that is closely related to endostatin. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in abnormal muscle cells of variable size (including atrophic and split muscle cells), susceptibility to exercise-induced muscle injury, and abnormalities in heart and skeletal muscle capillary endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Chrng A T 1: 87,207,240 probably null Het
Cnksr1 T C 4: 134,235,773 probably null Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Map2k3 G A 11: 60,945,567 probably null Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ncor2 T C 5: 125,110,079 probably null Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Nme3 A G 17: 24,897,063 probably null Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Strbp A T 2: 37,641,137 probably null Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Col15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Col15a1 APN 4 47208450 missense possibly damaging 0.86
IGL01561:Col15a1 APN 4 47312118 missense possibly damaging 0.87
IGL01750:Col15a1 APN 4 47303897 missense probably damaging 1.00
IGL02112:Col15a1 APN 4 47253985 splice site probably benign
IGL02158:Col15a1 APN 4 47300606 unclassified probably null
IGL02268:Col15a1 APN 4 47245380 missense probably damaging 0.99
IGL02325:Col15a1 APN 4 47289364 missense probably damaging 1.00
IGL02583:Col15a1 APN 4 47279866 missense probably benign 0.00
IGL02699:Col15a1 APN 4 47284471 unclassified probably benign
IGL03167:Col15a1 APN 4 47282635 missense probably damaging 0.99
IGL03174:Col15a1 APN 4 47282666 missense probably damaging 0.99
R0119:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0299:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0499:Col15a1 UTSW 4 47262950 missense probably damaging 0.98
R0567:Col15a1 UTSW 4 47293231 missense possibly damaging 0.89
R0607:Col15a1 UTSW 4 47282654 missense probably damaging 0.99
R0992:Col15a1 UTSW 4 47300491 missense probably damaging 0.96
R1165:Col15a1 UTSW 4 47257275 splice site probably benign
R1191:Col15a1 UTSW 4 47254083 nonsense probably null
R1852:Col15a1 UTSW 4 47299278 critical splice donor site probably null
R2349:Col15a1 UTSW 4 47306742 missense probably damaging 0.99
R2512:Col15a1 UTSW 4 47245868 missense possibly damaging 0.95
R2517:Col15a1 UTSW 4 47208492 missense probably damaging 0.98
R2895:Col15a1 UTSW 4 47312091 missense possibly damaging 0.59
R3688:Col15a1 UTSW 4 47258689 missense probably benign 0.00
R3848:Col15a1 UTSW 4 47289374 missense possibly damaging 0.73
R4430:Col15a1 UTSW 4 47245705 missense probably damaging 1.00
R4587:Col15a1 UTSW 4 47257184 missense probably damaging 1.00
R4793:Col15a1 UTSW 4 47262997 missense possibly damaging 0.83
R4812:Col15a1 UTSW 4 47262479 missense possibly damaging 0.93
R4922:Col15a1 UTSW 4 47258719 missense probably benign
R5233:Col15a1 UTSW 4 47296112 missense possibly damaging 0.74
R5602:Col15a1 UTSW 4 47312087 missense probably damaging 1.00
R5786:Col15a1 UTSW 4 47280865 missense possibly damaging 0.84
R5910:Col15a1 UTSW 4 47289514 missense probably damaging 1.00
R5921:Col15a1 UTSW 4 47300602 missense probably damaging 0.99
R5974:Col15a1 UTSW 4 47258683 missense probably benign 0.02
R5985:Col15a1 UTSW 4 47284507 missense probably damaging 0.99
R6010:Col15a1 UTSW 4 47245630 missense probably benign 0.03
R6720:Col15a1 UTSW 4 47247552 critical splice donor site probably null
R6791:Col15a1 UTSW 4 47300518 missense probably damaging 1.00
R6855:Col15a1 UTSW 4 47245544 missense probably damaging 1.00
R6965:Col15a1 UTSW 4 47247533 missense probably damaging 0.96
R7201:Col15a1 UTSW 4 47307752 missense possibly damaging 0.92
R7273:Col15a1 UTSW 4 47284467 splice site probably null
R7413:Col15a1 UTSW 4 47245431 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCTTGAAAGGAAGCTGAGTCC -3'
(R):5'- AGAGTCAATAGTTCCCAAGGGG -3'

Sequencing Primer
(F):5'- TGAGTCCAGGCCACCTCTAG -3'
(R):5'- GGGCCAATCTACAGTCACTGTTG -3'
Posted On2019-06-26