Mutagenetix > Incidental Mutation

Incidental Mutation 'R0582:Ttc28'

56462

Institutional Source

Beutler Lab

Gene Symbol

Ttc28

Ensembl Gene

ENSMUSG00000033209

Gene Name

tetratricopeptide repeat domain 28

Synonyms

MMRRC Submission

038772-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0582 (G1)

Quality Score

146

Status

Validated

Chromosome

Chromosomal Location

110879803-111289780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 111183296 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 430 (A430S)

Ref Sequence

ENSEMBL: ENSMUSP00000137609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]

AlphaFold

Q80XJ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000040111
AA Change: A461S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: A461S

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	339	372	1.78e-1	SMART
TPR	379	412	2.82e-4	SMART
TPR	419	452	9.98e-5	SMART
TPR	459	492	1.88e0	SMART
TPR	499	532	1.11e1	SMART
TPR	539	572	2.93e-2	SMART
TPR	579	612	1.21e-3	SMART
TPR	619	652	4.91e-4	SMART
TPR	659	692	7.56e-5	SMART
TPR	699	732	8.29e0	SMART
TPR	739	772	1.63e0	SMART
TPR	779	812	1.24e0	SMART
TPR	819	852	7.98e-4	SMART
TPR	859	892	8.74e0	SMART
TPR	902	935	5.43e-6	SMART
TPR	942	975	4.09e-1	SMART
TPR	982	1015	9.98e-5	SMART
TPR	1022	1055	7.12e-1	SMART
TPR	1062	1095	5.69e0	SMART
TPR	1102	1135	3.14e-2	SMART
TPR	1142	1175	2.84e1	SMART
low complexity region	1259	1277	N/A	INTRINSIC
Pfam:CHAT	1415	1738	7.3e-77	PFAM
low complexity region	1972	1990	N/A	INTRINSIC
low complexity region	2014	2031	N/A	INTRINSIC
low complexity region	2033	2045	N/A	INTRINSIC
low complexity region	2155	2171	N/A	INTRINSIC
low complexity region	2283	2293	N/A	INTRINSIC
low complexity region	2327	2352	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156290
AA Change: A430S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: A430S

Domain	Start	End	E-Value	Type
low complexity region	4	28	N/A	INTRINSIC
TPR	52	85	2.84e1	SMART
TPR	86	119	5.03e-1	SMART
TPR	120	153	2.11e-3	SMART
TPR	268	301	8.51e0	SMART
TPR	308	341	1.78e-1	SMART
TPR	348	381	2.82e-4	SMART
TPR	388	421	9.98e-5	SMART
TPR	428	461	1.88e0	SMART
TPR	468	501	1.11e1	SMART
TPR	508	541	2.93e-2	SMART
TPR	548	581	1.21e-3	SMART
TPR	588	621	4.91e-4	SMART
TPR	628	661	7.56e-5	SMART
TPR	668	701	8.29e0	SMART
TPR	708	741	1.63e0	SMART
TPR	748	781	1.24e0	SMART
TPR	788	821	7.98e-4	SMART
TPR	828	861	8.74e0	SMART
TPR	871	904	5.43e-6	SMART
TPR	911	944	4.09e-1	SMART
TPR	951	984	9.98e-5	SMART
TPR	991	1024	7.12e-1	SMART
TPR	1031	1064	5.69e0	SMART
TPR	1071	1104	3.14e-2	SMART
TPR	1111	1144	2.84e1	SMART
low complexity region	1228	1246	N/A	INTRINSIC
Pfam:CHAT	1384	1707	1.1e-76	PFAM
low complexity region	1941	1959	N/A	INTRINSIC
low complexity region	1983	2000	N/A	INTRINSIC
low complexity region	2002	2014	N/A	INTRINSIC
low complexity region	2124	2140	N/A	INTRINSIC
low complexity region	2252	2262	N/A	INTRINSIC
low complexity region	2296	2321	N/A	INTRINSIC

Meta Mutation Damage Score

0.1237

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.6%

Validation Efficiency

100% (45/45)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,125,082		noncoding transcript	Het
Abcb5	A	T	12: 118,940,412	M186K	probably benign	Het
Afm	T	C	5: 90,524,780		probably benign	Het
Arfgef3	G	A	10: 18,611,290	A1332V	probably damaging	Het
Atp11a	T	C	8: 12,831,214	S451P	probably benign	Het
Birc6	T	A	17: 74,643,337	V3189E	probably damaging	Het
Ccdc150	C	T	1: 54,329,511	A626V	probably benign	Het
Ccdc50	G	A	16: 27,444,659		probably benign	Het
Cntln	T	C	4: 84,884,741	S93P	probably damaging	Het
Ctnna2	C	A	6: 77,758,417	V106L	probably benign	Het
Ctnnal1	G	C	4: 56,813,228	Q668E	probably damaging	Het
Cyp1a2	G	A	9: 57,680,246		probably benign	Het
Dnah8	A	G	17: 30,718,961	D1604G	probably benign	Het
Dscaml1	A	T	9: 45,668,264	I370F	possibly damaging	Het
Ears2	T	C	7: 122,055,658	E129G	probably benign	Het
Gm4981	A	T	10: 58,235,686	S235R	probably benign	Het
Igsf10	T	C	3: 59,319,767	I2162V	probably benign	Het
Ints9	C	T	14: 64,980,149	P42S	probably damaging	Het
Ipp	T	C	4: 116,515,467	L231S	probably damaging	Het
Lyn	T	A	4: 3,743,296	L72Q	probably damaging	Het
Nfe2l2	T	A	2: 75,676,768	E329D	probably damaging	Het
Olfr628	G	A	7: 103,732,673	C249Y	possibly damaging	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pdyn	A	C	2: 129,689,738	L44R	probably damaging	Het
Pkd1l1	A	G	11: 8,931,699		probably benign	Het
Prpf40a	A	T	2: 53,145,692	F695L	probably damaging	Het
Rnf217	A	G	10: 31,608,767	Y140H	possibly damaging	Het
Sema6c	C	T	3: 95,169,197	R265C	probably damaging	Het
Slc7a8	C	A	14: 54,758,444	C167F	probably damaging	Het
Snap47	A	T	11: 59,428,433	L293*	probably null	Het
Snx3	A	T	10: 42,533,280		probably benign	Het
Sycp2l	T	A	13: 41,137,955		probably benign	Het
Taar3	A	G	10: 23,949,817	Y87C	probably damaging	Het
Tm4sf4	T	C	3: 57,433,857		probably benign	Het
Tssc4	T	C	7: 143,070,509	S185P	probably damaging	Het
Vmn2r27	T	C	6: 124,224,290	D236G	probably benign	Het
Vps54	G	T	11: 21,300,137	D508Y	probably damaging	Het
Wdr53	G	A	16: 32,251,908	V24M	probably damaging	Het
Xirp2	T	G	2: 67,508,866	L484V	probably benign	Het
Zfyve26	T	C	12: 79,246,222	D2051G	probably damaging	Het

Other mutations in Ttc28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Ttc28	APN	5	111225688	missense	probably damaging	1.00
IGL00963:Ttc28	APN	5	111286389	nonsense	probably null
IGL00969:Ttc28	APN	5	111225740	missense	probably benign	0.00
IGL01366:Ttc28	APN	5	111085171	critical splice donor site	probably null
IGL01528:Ttc28	APN	5	111101960	splice site	probably benign
IGL01558:Ttc28	APN	5	111283962	missense	probably damaging	0.99
IGL01973:Ttc28	APN	5	111224235	missense	possibly damaging	0.88
IGL02040:Ttc28	APN	5	110892936	nonsense	probably null
IGL02432:Ttc28	APN	5	111223235	missense	probably damaging	1.00
IGL02531:Ttc28	APN	5	111225850	missense	probably damaging	1.00
IGL02819:Ttc28	APN	5	111266583	missense	probably benign
IGL02830:Ttc28	APN	5	111286239	missense	probably benign	0.10
IGL02893:Ttc28	APN	5	111285385	missense	possibly damaging	0.87
IGL03387:Ttc28	APN	5	111233342	missense	probably benign	0.07
PIT4131001:Ttc28	UTSW	5	110892853	missense	probably benign	0.00
R0142:Ttc28	UTSW	5	111277457	missense	probably benign	0.40
R0166:Ttc28	UTSW	5	111225634	missense	probably benign	0.01
R0328:Ttc28	UTSW	5	111284067	splice site	probably benign
R0744:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R0811:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0812:Ttc28	UTSW	5	111235500	missense	probably benign	0.24
R0828:Ttc28	UTSW	5	111223446	missense	probably damaging	1.00
R0833:Ttc28	UTSW	5	111231081	missense	probably damaging	1.00
R1013:Ttc28	UTSW	5	111276965	missense	probably benign	0.01
R1168:Ttc28	UTSW	5	111231111	missense	probably damaging	1.00
R1194:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1195:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1196:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1205:Ttc28	UTSW	5	111285769	missense	probably benign	0.04
R1386:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1467:Ttc28	UTSW	5	111285388	missense	probably benign	0.00
R1537:Ttc28	UTSW	5	111285318	missense	probably damaging	0.96
R1539:Ttc28	UTSW	5	111100811	missense	possibly damaging	0.77
R1558:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1560:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1561:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1566:Ttc28	UTSW	5	111225677	missense	probably damaging	1.00
R1768:Ttc28	UTSW	5	111277168	missense	possibly damaging	0.77
R1775:Ttc28	UTSW	5	111276811	missense	probably benign	0.00
R1909:Ttc28	UTSW	5	111284054	critical splice donor site	probably null
R1911:Ttc28	UTSW	5	111280750	missense	possibly damaging	0.93
R1970:Ttc28	UTSW	5	111235635	missense	probably benign	0.00
R1990:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R1992:Ttc28	UTSW	5	111276322	missense	probably benign	0.37
R2066:Ttc28	UTSW	5	111225933	missense	probably benign	0.01
R2112:Ttc28	UTSW	5	111276273	missense	probably damaging	0.99
R2158:Ttc28	UTSW	5	111177617	intron	probably benign
R2192:Ttc28	UTSW	5	111223496	missense	probably damaging	0.99
R2267:Ttc28	UTSW	5	111226003	missense	possibly damaging	0.75
R2384:Ttc28	UTSW	5	111276208	missense	possibly damaging	0.95
R2989:Ttc28	UTSW	5	111224015	missense	probably benign	0.29
R3881:Ttc28	UTSW	5	111183240	missense	probably damaging	1.00
R3919:Ttc28	UTSW	5	111285379	missense	possibly damaging	0.80
R4455:Ttc28	UTSW	5	111224058	frame shift	probably null
R4456:Ttc28	UTSW	5	111224058	frame shift	probably null
R4522:Ttc28	UTSW	5	111280172	missense	probably benign	0.01
R4548:Ttc28	UTSW	5	111271224	missense	possibly damaging	0.86
R4591:Ttc28	UTSW	5	111223281	missense	probably damaging	1.00
R4633:Ttc28	UTSW	5	111224001	missense	probably damaging	1.00
R4700:Ttc28	UTSW	5	111277043	missense	probably damaging	1.00
R4714:Ttc28	UTSW	5	111285229	missense	possibly damaging	0.65
R4790:Ttc28	UTSW	5	111224217	missense	possibly damaging	0.94
R4803:Ttc28	UTSW	5	111277463	missense	possibly damaging	0.90
R4840:Ttc28	UTSW	5	111286081	missense	probably damaging	1.00
R4969:Ttc28	UTSW	5	111276255	missense	probably damaging	0.96
R5019:Ttc28	UTSW	5	111102064	missense	possibly damaging	0.47
R5130:Ttc28	UTSW	5	110892856	missense	probably benign
R5150:Ttc28	UTSW	5	111225689	missense	probably damaging	1.00
R5214:Ttc28	UTSW	5	111177623	intron	probably benign
R5254:Ttc28	UTSW	5	111271238	missense	probably benign	0.01
R5518:Ttc28	UTSW	5	111225928	missense	probably benign	0.17
R5851:Ttc28	UTSW	5	111235469	splice site	probably benign
R5931:Ttc28	UTSW	5	111085109	missense	possibly damaging	0.81
R6011:Ttc28	UTSW	5	111286443	missense	probably benign
R6176:Ttc28	UTSW	5	111223985	missense	probably damaging	1.00
R6221:Ttc28	UTSW	5	111271248	missense	probably benign	0.00
R6398:Ttc28	UTSW	5	111276276	missense	probably damaging	1.00
R6717:Ttc28	UTSW	5	111285436	missense	probably benign
R6770:Ttc28	UTSW	5	111286140	missense	probably damaging	1.00
R6901:Ttc28	UTSW	5	111277025	missense	possibly damaging	0.88
R7038:Ttc28	UTSW	5	111266579	missense	probably benign	0.09
R7073:Ttc28	UTSW	5	111223416	missense	possibly damaging	0.96
R7101:Ttc28	UTSW	5	111085092	missense	probably damaging	1.00
R7135:Ttc28	UTSW	5	111280007	missense	probably damaging	1.00
R7350:Ttc28	UTSW	5	111226037	missense	probably damaging	0.97
R7454:Ttc28	UTSW	5	111285484	missense	probably benign	0.19
R7461:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7596:Ttc28	UTSW	5	111280124	missense	probably damaging	1.00
R7613:Ttc28	UTSW	5	111224129	missense	probably damaging	1.00
R7625:Ttc28	UTSW	5	111285219	missense	possibly damaging	0.65
R7648:Ttc28	UTSW	5	111183392	missense	possibly damaging	0.52
R7735:Ttc28	UTSW	5	111266678	splice site	probably null
R8030:Ttc28	UTSW	5	111286056	missense	possibly damaging	0.81
R8205:Ttc28	UTSW	5	111225730	missense	possibly damaging	0.95
R8246:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8247:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8269:Ttc28	UTSW	5	111277459	missense	probably benign	0.09
R8292:Ttc28	UTSW	5	111223257	missense	probably damaging	1.00
R8346:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8356:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8423:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8424:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8426:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8441:Ttc28	UTSW	5	111177641	nonsense	probably null
R8494:Ttc28	UTSW	5	111235640	missense	probably damaging	0.96
R8508:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8510:Ttc28	UTSW	5	111233341	missense	probably benign	0.33
R8729:Ttc28	UTSW	5	111235643	critical splice donor site	probably null
R8845:Ttc28	UTSW	5	111224175	missense	probably benign	0.11
R9003:Ttc28	UTSW	5	111277030	missense	probably benign	0.00
R9185:Ttc28	UTSW	5	111223476	missense	probably benign	0.03
R9187:Ttc28	UTSW	5	111102036	missense	probably damaging	1.00
R9245:Ttc28	UTSW	5	111177659	missense	unknown
R9251:Ttc28	UTSW	5	110892832	missense	possibly damaging	0.47
R9372:Ttc28	UTSW	5	111183207	missense	probably benign	0.25
R9466:Ttc28	UTSW	5	111183029	missense	probably damaging	0.99
R9563:Ttc28	UTSW	5	111223226	missense	probably benign	0.22
R9606:Ttc28	UTSW	5	111285274	missense	probably benign	0.00
R9691:Ttc28	UTSW	5	111284013	missense	probably benign	0.01
R9709:Ttc28	UTSW	5	111285771	missense	probably damaging	0.97
V8831:Ttc28	UTSW	5	111100712	missense	probably benign	0.11
Z1088:Ttc28	UTSW	5	111286315	missense	probably benign	0.00
Z1176:Ttc28	UTSW	5	111266566	missense	possibly damaging	0.59
Z1177:Ttc28	UTSW	5	111278586	missense	probably damaging	1.00
Z1177:Ttc28	UTSW	5	111285739	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GATGACCTTTCTGAAGCCCGAGAAC -3'
(R):5'- GCACAGAAGAGACAATGTGCTTTGC -3'

Sequencing Primer
(F):5'- GTGACTTTGAGAACGCCG -3'
(R):5'- CTTTGCAGTAGGCAGATTCAG -3'

Posted On

2013-07-11