Incidental Mutation 'R7261:Scn11a'
ID 564632
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 045387-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7261 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119648899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 55 (D55N)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: D55N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: D55N

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: D55N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,259,526 (GRCm39) F1954L probably damaging Het
Acmsd T G 1: 127,687,561 (GRCm39) I281R probably damaging Het
Adamts2 A T 11: 50,677,424 (GRCm39) M742L possibly damaging Het
Adgrf4 G A 17: 42,978,326 (GRCm39) T339I probably benign Het
Aff1 T C 5: 103,976,245 (GRCm39) S448P probably damaging Het
Agbl2 A T 2: 90,619,288 (GRCm39) S38C possibly damaging Het
Akap7 C T 10: 25,147,416 (GRCm39) D105N possibly damaging Het
Arhgap21 A G 2: 20,885,177 (GRCm39) F677L probably benign Het
Atf6b G T 17: 34,869,792 (GRCm39) V271F probably damaging Het
B3gnt5 A G 16: 19,588,123 (GRCm39) Y114C probably damaging Het
Casp7 T A 19: 56,424,765 (GRCm39) D161E probably benign Het
Catsper4 TTCTC TTC 4: 133,954,423 (GRCm39) probably null Het
Ccdc162 T C 10: 41,437,136 (GRCm39) T1758A probably benign Het
Cfap74 C A 4: 155,549,831 (GRCm39) P155T unknown Het
Champ1 A G 8: 13,928,517 (GRCm39) D225G possibly damaging Het
Chrng A T 1: 87,134,962 (GRCm39) probably null Het
Cnksr1 T C 4: 133,963,084 (GRCm39) probably null Het
Col15a1 G A 4: 47,269,088 (GRCm39) G582D probably benign Het
Cwc25 A G 11: 97,648,585 (GRCm39) V81A possibly damaging Het
Ddhd1 A G 14: 45,894,688 (GRCm39) Y261H probably damaging Het
Defa29 A G 8: 21,816,818 (GRCm39) probably null Het
Diaph3 A C 14: 87,202,893 (GRCm39) C666G probably benign Het
Dlx2 A G 2: 71,375,019 (GRCm39) Y282H probably damaging Het
Dsc3 A T 18: 20,113,814 (GRCm39) Y369* probably null Het
Dtwd1 A G 2: 126,000,424 (GRCm39) N120S probably benign Het
Dysf G A 6: 84,169,992 (GRCm39) S1761N probably damaging Het
Enthd1 A T 15: 80,444,416 (GRCm39) N46K probably damaging Het
Epha7 T A 4: 28,813,418 (GRCm39) I12N probably benign Het
Fam171a2 T A 11: 102,328,900 (GRCm39) N620Y probably damaging Het
Garin4 T C 1: 190,896,308 (GRCm39) S112G unknown Het
Gfpt2 A T 11: 49,714,078 (GRCm39) E278D possibly damaging Het
Gm3285 A G 10: 77,698,244 (GRCm39) Q131R unknown Het
Gpcpd1 A C 2: 132,410,619 (GRCm39) C23G probably damaging Het
Gtpbp4 A T 13: 9,037,954 (GRCm39) H228Q probably benign Het
Hdac7 A G 15: 97,704,415 (GRCm39) V500A probably benign Het
Hykk T G 9: 54,828,010 (GRCm39) M83R possibly damaging Het
Idi1 A G 13: 8,936,931 (GRCm39) I101V probably benign Het
Irs2 A T 8: 11,057,018 (GRCm39) H471Q possibly damaging Het
Itsn1 T C 16: 91,702,194 (GRCm39) V12A probably benign Het
Jak2 A G 19: 29,288,385 (GRCm39) I1079V possibly damaging Het
Kcnt2 G A 1: 140,282,255 (GRCm39) R80H possibly damaging Het
Lamb2 T C 9: 108,358,496 (GRCm39) Y178H probably damaging Het
Lgr5 A T 10: 115,423,370 (GRCm39) L10Q possibly damaging Het
Lnx1 G T 5: 74,838,175 (GRCm39) S29* probably null Het
Lpcat3 T A 6: 124,675,050 (GRCm39) F57I probably benign Het
Manf T C 9: 106,769,088 (GRCm39) T4A probably benign Het
Map2k3 G A 11: 60,836,393 (GRCm39) probably null Het
Myh14 G A 7: 44,273,761 (GRCm39) Q1329* probably null Het
Myocd T C 11: 65,078,422 (GRCm39) S458G probably damaging Het
Ncor2 T C 5: 125,187,143 (GRCm39) probably null Het
Ndufs8 A T 19: 3,961,606 (GRCm39) N23K probably benign Het
Nkx6-1 T C 5: 101,812,006 (GRCm39) K32R unknown Het
Nlrp3 T G 11: 59,439,272 (GRCm39) V283G possibly damaging Het
Nme3 A G 17: 25,116,037 (GRCm39) probably null Het
Or1o3 A G 17: 37,574,076 (GRCm39) F160L probably benign Het
Or8g23 C T 9: 38,971,504 (GRCm39) V153M possibly damaging Het
Parvg T C 15: 84,215,297 (GRCm39) probably null Het
Peg10 T A 6: 4,756,591 (GRCm39) M389K unknown Het
Phf23 G T 11: 69,890,091 (GRCm39) C340F possibly damaging Het
Piwil2 A G 14: 70,611,860 (GRCm39) Y929H probably damaging Het
Prss39 A G 1: 34,539,369 (GRCm39) D203G probably damaging Het
Prss54 G T 8: 96,286,367 (GRCm39) D235E probably benign Het
Prtg T A 9: 72,815,117 (GRCm39) M1015K possibly damaging Het
Rbbp8 T C 18: 11,838,799 (GRCm39) I160T probably damaging Het
Rxylt1 A T 10: 121,924,822 (GRCm39) D293E probably benign Het
Scn10a C A 9: 119,438,790 (GRCm39) C1692F probably damaging Het
Secisbp2 G T 13: 51,836,498 (GRCm39) V768F probably damaging Het
Skic3 A G 13: 76,261,698 (GRCm39) T138A probably benign Het
Spag16 T C 1: 70,338,780 (GRCm39) I426T possibly damaging Het
Sspo G A 6: 48,427,011 (GRCm39) V250M possibly damaging Het
Strbp A T 2: 37,531,149 (GRCm39) probably null Het
Sv2c C T 13: 96,224,809 (GRCm39) V167M probably damaging Het
Tdpoz1 G A 3: 93,577,794 (GRCm39) S330L not run Het
Tigd2 T A 6: 59,188,052 (GRCm39) D306E probably benign Het
Trrap C T 5: 144,782,287 (GRCm39) P3278S possibly damaging Het
Vdac1 A T 11: 52,265,761 (GRCm39) K28N probably damaging Het
Vmn1r84 A T 7: 12,096,069 (GRCm39) M208K probably damaging Het
Vmn2r77 A T 7: 86,460,518 (GRCm39) K615* probably null Het
Vps11 A G 9: 44,265,800 (GRCm39) L493P probably damaging Het
Zbtb21 T C 16: 97,754,179 (GRCm39) I35V possibly damaging Het
Zbtb26 A T 2: 37,326,667 (GRCm39) M123K possibly damaging Het
Zfp236 A T 18: 82,627,470 (GRCm39) D1576E possibly damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TACTGACCCCAAGACTGGATTC -3'
(R):5'- AGCTGTGTTTCTGCCACAC -3'

Sequencing Primer
(F):5'- TTCAGAGAACCAGTAGTGCAC -3'
(R):5'- CACACAGTGTCTGAGCCAAGG -3'
Posted On 2019-06-26