Incidental Mutation 'R7261:Adamts2'
ID564640
Institutional Source Beutler Lab
Gene Symbol Adamts2
Ensembl Gene ENSMUSG00000036545
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2
SynonymsADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R7261 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50602084-50807573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50786597 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 742 (M742L)
Ref Sequence ENSEMBL: ENSMUSP00000040171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040523]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040523
AA Change: M742L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040171
Gene: ENSMUSG00000036545
AA Change: M742L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 211 2.6e-39 PFAM
low complexity region 214 225 N/A INTRINSIC
coiled coil region 236 260 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 1.4e-15 PFAM
Pfam:Reprolysin_4 267 464 7.1e-11 PFAM
Pfam:Reprolysin 268 471 2.4e-20 PFAM
Pfam:Reprolysin_2 285 463 9.1e-14 PFAM
Pfam:Reprolysin_3 289 420 8.7e-13 PFAM
TSP1 565 617 9.73e-17 SMART
Pfam:ADAM_spacer1 724 838 5.1e-33 PFAM
low complexity region 839 853 N/A INTRINSIC
TSP1 858 915 1.05e-3 SMART
TSP1 918 977 2.78e-3 SMART
TSP1 980 1030 4.99e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin repeats) family of proteinases that is involved in the proteolytic processing of procollagens. The encoded protein precursor is proteolytically processed to generate a mature, zinc-dependent enzyme. Mice lacking the encoded protein develop abnormal lungs, fragile skin and male sterility. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in a short snout, male infertility, and thin skin that is torn by scratching or handling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Chrng A T 1: 87,207,240 probably null Het
Cnksr1 T C 4: 134,235,773 probably null Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Map2k3 G A 11: 60,945,567 probably null Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ncor2 T C 5: 125,110,079 probably null Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Nme3 A G 17: 24,897,063 probably null Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Strbp A T 2: 37,641,137 probably null Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Adamts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Adamts2 APN 11 50803701 missense probably benign 0.00
IGL01366:Adamts2 APN 11 50796468 missense probably damaging 1.00
IGL01412:Adamts2 APN 11 50795403 missense probably benign 0.43
IGL01443:Adamts2 APN 11 50803863 missense possibly damaging 0.54
IGL01974:Adamts2 APN 11 50776174 missense probably damaging 0.99
IGL02267:Adamts2 APN 11 50792678 missense probably benign 0.00
IGL02498:Adamts2 APN 11 50773308 missense possibly damaging 0.81
IGL02498:Adamts2 APN 11 50777196 missense probably damaging 1.00
IGL02626:Adamts2 APN 11 50776255 missense probably damaging 0.99
IGL02634:Adamts2 APN 11 50792721 nonsense probably null
IGL02643:Adamts2 APN 11 50788700 missense probably benign 0.01
IGL02836:Adamts2 APN 11 50787279 missense probably damaging 1.00
IGL03012:Adamts2 APN 11 50776269 splice site probably benign
ANU22:Adamts2 UTSW 11 50737363 missense probably benign 0.06
H8441:Adamts2 UTSW 11 50784678 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0050:Adamts2 UTSW 11 50775395 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0240:Adamts2 UTSW 11 50775374 missense probably damaging 1.00
R0491:Adamts2 UTSW 11 50776630 missense probably damaging 0.98
R0501:Adamts2 UTSW 11 50668145 missense probably benign 0.16
R0570:Adamts2 UTSW 11 50776136 missense probably damaging 1.00
R0588:Adamts2 UTSW 11 50776664 missense probably damaging 1.00
R0647:Adamts2 UTSW 11 50603438 missense probably damaging 1.00
R0760:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R0784:Adamts2 UTSW 11 50668003 missense probably damaging 1.00
R1163:Adamts2 UTSW 11 50779714 missense probably damaging 1.00
R1623:Adamts2 UTSW 11 50668115 missense possibly damaging 0.79
R1641:Adamts2 UTSW 11 50792785 missense probably damaging 1.00
R1779:Adamts2 UTSW 11 50756697 missense probably damaging 0.99
R2163:Adamts2 UTSW 11 50788805 missense probably benign 0.36
R2177:Adamts2 UTSW 11 50777228 missense probably damaging 0.98
R2508:Adamts2 UTSW 11 50788689 missense possibly damaging 0.82
R3721:Adamts2 UTSW 11 50773211 splice site probably benign
R4092:Adamts2 UTSW 11 50787276 missense probably damaging 0.99
R4691:Adamts2 UTSW 11 50756696 missense probably damaging 1.00
R4785:Adamts2 UTSW 11 50792722 missense probably benign 0.00
R4809:Adamts2 UTSW 11 50803690 missense probably benign 0.17
R4823:Adamts2 UTSW 11 50737187 missense probably benign 0.26
R4927:Adamts2 UTSW 11 50803812 nonsense probably null
R4976:Adamts2 UTSW 11 50737366 missense possibly damaging 0.67
R5118:Adamts2 UTSW 11 50781869 missense probably damaging 0.99
R5478:Adamts2 UTSW 11 50792651 missense possibly damaging 0.83
R5660:Adamts2 UTSW 11 50776645 missense probably damaging 1.00
R5734:Adamts2 UTSW 11 50788667 missense probably damaging 1.00
R5865:Adamts2 UTSW 11 50803954 nonsense probably null
R6079:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6138:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
R6257:Adamts2 UTSW 11 50775326 missense probably damaging 1.00
R6540:Adamts2 UTSW 11 50788740 missense possibly damaging 0.77
R6897:Adamts2 UTSW 11 50737164 critical splice acceptor site probably null
R7103:Adamts2 UTSW 11 50737354 missense probably damaging 0.98
R7229:Adamts2 UTSW 11 50791820 missense probably damaging 1.00
R7335:Adamts2 UTSW 11 50602266 missense probably benign 0.18
R7373:Adamts2 UTSW 11 50795435 missense probably benign 0.00
R7505:Adamts2 UTSW 11 50796520 missense probably benign 0.00
R7971:Adamts2 UTSW 11 50756696 missense probably damaging 1.00
R8081:Adamts2 UTSW 11 50777177 missense probably damaging 0.99
R8167:Adamts2 UTSW 11 50779714 missense probably damaging 1.00
R8256:Adamts2 UTSW 11 50792756 missense probably benign 0.41
R8298:Adamts2 UTSW 11 50777131 missense possibly damaging 0.91
R8343:Adamts2 UTSW 11 50603488 missense probably damaging 1.00
U15987:Adamts2 UTSW 11 50756706 missense probably damaging 1.00
X0065:Adamts2 UTSW 11 50803649 nonsense probably null
Z1176:Adamts2 UTSW 11 50792708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTGGAACCTGAACATTC -3'
(R):5'- TCAAGGCGGTTGATCTCAGG -3'

Sequencing Primer
(F):5'- AGAGGCACCTGGGACTTG -3'
(R):5'- TTGATCTCAGGACCTGGCCAC -3'
Posted On2019-06-26