Incidental Mutation 'R7261:Vdac1'
ID564641
Institutional Source Beutler Lab
Gene Symbol Vdac1
Ensembl Gene ENSMUSG00000020402
Gene Namevoltage-dependent anion channel 1
SynonymsVdac5
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R7261 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52360860-52389397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52374934 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 28 (K28N)
Ref Sequence ENSEMBL: ENSMUSP00000099819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020673] [ENSMUST00000102758] [ENSMUST00000125694]
PDB Structure
The Crystal Structure of Mouse VDAC1 at 2.3 A resolution [X-RAY DIFFRACTION]
ATP binding to murine voltage-dependent anion channel 1 (mVDAC1). [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020673
AA Change: K41N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020673
Gene: ENSMUSG00000020402
AA Change: K41N

DomainStartEndE-ValueType
Pfam:Porin_3 16 289 1.7e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102758
AA Change: K28N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099819
Gene: ENSMUSG00000020402
AA Change: K28N

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 7.6e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125694
AA Change: K28N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116919
Gene: ENSMUSG00000020402
AA Change: K28N

DomainStartEndE-ValueType
Pfam:Porin_3 3 235 1.7e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Multiple pseudogenes of this gene are found on chromosomes 1, 2, 3, 6, 8, 9, and X. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants exhibit approximately 60% embryonic mortality, with loss occurring at embryonic day 10.5-11.5. Survivors exhibit defective cued fear conditioning and spatial learning. Heterozygotes also exhibit about 12% prenatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Chrng A T 1: 87,207,240 probably null Het
Cnksr1 T C 4: 134,235,773 probably null Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Map2k3 G A 11: 60,945,567 probably null Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ncor2 T C 5: 125,110,079 probably null Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Nme3 A G 17: 24,897,063 probably null Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Strbp A T 2: 37,641,137 probably null Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Vdac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Vdac1 APN 11 52385662 missense probably benign 0.02
IGL02057:Vdac1 APN 11 52376544 critical splice donor site probably null
IGL03223:Vdac1 APN 11 52376655 missense probably benign
IGL03225:Vdac1 APN 11 52376655 missense probably benign
R0362:Vdac1 UTSW 11 52374973 splice site probably benign
R1612:Vdac1 UTSW 11 52384070 missense probably benign 0.03
R1694:Vdac1 UTSW 11 52374363 missense probably damaging 0.96
R2512:Vdac1 UTSW 11 52384077 missense probably damaging 1.00
R3717:Vdac1 UTSW 11 52376646 critical splice acceptor site probably null
R4592:Vdac1 UTSW 11 52374972 splice site probably null
R5027:Vdac1 UTSW 11 52388478 missense possibly damaging 0.75
R5209:Vdac1 UTSW 11 52376452 missense probably damaging 0.99
R5256:Vdac1 UTSW 11 52384078 critical splice donor site probably null
R5413:Vdac1 UTSW 11 52374967 missense probably null 0.17
R5762:Vdac1 UTSW 11 52387453 missense possibly damaging 0.77
R6276:Vdac1 UTSW 11 52376482 missense possibly damaging 0.84
R6954:Vdac1 UTSW 11 52386373 missense probably damaging 1.00
R7023:Vdac1 UTSW 11 52374366 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGTCCTAGCTTCAAGC -3'
(R):5'- TGGGTACAGCACACACCTAC -3'

Sequencing Primer
(F):5'- agatacacctccaactcc -3'
(R):5'- CAGTACATTAGGCCAGAAGTTTTG -3'
Posted On2019-06-26