Mutagenetix > Incidental Mutation

Incidental Mutation 'R7261:Nlrp3'

564642

Institutional Source

Beutler Lab

Gene Symbol

Nlrp3

Ensembl Gene

ENSMUSG00000032691

Gene Name

NLR family, pyrin domain containing 3

Synonyms

Cias1, cryopyrin, Pypaf1, NALP3, Mmig1

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R7261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59541568-59566956 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 59548446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 283 (V283G)

Ref Sequence

ENSEMBL: ENSMUSP00000078440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]

AlphaFold

Q8R4B8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079476
AA Change: V283G

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: V283G

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101148
AA Change: V283G

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: V283G

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149126

SMART Domains

Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

99% (84/85)

MGI Phenotype

Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,368,700	F1954L	probably damaging	Het
Acmsd	T	G	1: 127,759,824	I281R	probably damaging	Het
Adamts2	A	T	11: 50,786,597	M742L	possibly damaging	Het
Adgrf4	G	A	17: 42,667,435	T339I	probably benign	Het
Aff1	T	C	5: 103,828,379	S448P	probably damaging	Het
Agbl2	A	T	2: 90,788,944	S38C	possibly damaging	Het
Akap7	C	T	10: 25,271,518	D105N	possibly damaging	Het
Arhgap21	A	G	2: 20,880,366	F677L	probably benign	Het
Atf6b	G	T	17: 34,650,818	V271F	probably damaging	Het
B3gnt5	A	G	16: 19,769,373	Y114C	probably damaging	Het
Casp7	T	A	19: 56,436,333	D161E	probably benign	Het
Catsper4	TTCTC	TTC	4: 134,227,112		probably null	Het
Ccdc162	T	C	10: 41,561,140	T1758A	probably benign	Het
Cfap74	C	A	4: 155,465,374	P155T	unknown	Het
Champ1	A	G	8: 13,878,517	D225G	possibly damaging	Het
Chrng	A	T	1: 87,207,240		probably null	Het
Cnksr1	T	C	4: 134,235,773		probably null	Het
Col15a1	G	A	4: 47,269,088	G582D	probably benign	Het
Cwc25	A	G	11: 97,757,759	V81A	possibly damaging	Het
Ddhd1	A	G	14: 45,657,231	Y261H	probably damaging	Het
Defa29	A	G	8: 21,326,802		probably null	Het
Diaph3	A	C	14: 86,965,457	C666G	probably benign	Het
Dlx2	A	G	2: 71,544,675	Y282H	probably damaging	Het
Dsc3	A	T	18: 19,980,757	Y369*	probably null	Het
Dtwd1	A	G	2: 126,158,504	N120S	probably benign	Het
Dysf	G	A	6: 84,193,010	S1761N	probably damaging	Het
Enthd1	A	T	15: 80,560,215	N46K	probably damaging	Het
Epha7	T	A	4: 28,813,418	I12N	probably benign	Het
Fam171a2	T	A	11: 102,438,074	N620Y	probably damaging	Het
Fam71a	T	C	1: 191,164,111	S112G	unknown	Het
Gfpt2	A	T	11: 49,823,251	E278D	possibly damaging	Het
Gm3285	A	G	10: 77,862,410	Q131R	unknown	Het
Gpcpd1	A	C	2: 132,568,699	C23G	probably damaging	Het
Gtpbp4	A	T	13: 8,987,918	H228Q	probably benign	Het
Hdac7	A	G	15: 97,806,534	V500A	probably benign	Het
Hykk	T	G	9: 54,920,726	M83R	possibly damaging	Het
Idi1	A	G	13: 8,886,895	I101V	probably benign	Het
Irs2	A	T	8: 11,007,018	H471Q	possibly damaging	Het
Itsn1	T	C	16: 91,905,306	V12A	probably benign	Het
Jak2	A	G	19: 29,310,985	I1079V	possibly damaging	Het
Kcnt2	G	A	1: 140,354,517	R80H	possibly damaging	Het
Lamb2	T	C	9: 108,481,297	Y178H	probably damaging	Het
Lgr5	A	T	10: 115,587,465	L10Q	possibly damaging	Het
Lnx1	G	T	5: 74,677,514	S29*	probably null	Het
Lpcat3	T	A	6: 124,698,087	F57I	probably benign	Het
Manf	T	C	9: 106,891,889	T4A	probably benign	Het
Map2k3	G	A	11: 60,945,567		probably null	Het
Myh14	G	A	7: 44,624,337	Q1329*	probably null	Het
Myocd	T	C	11: 65,187,596	S458G	probably damaging	Het
Ncor2	T	C	5: 125,110,079		probably null	Het
Ndufs8	A	T	19: 3,911,606	N23K	probably benign	Het
Nkx6-1	T	C	5: 101,664,140	K32R	unknown	Het
Nme3	A	G	17: 24,897,063		probably null	Het
Olfr937	C	T	9: 39,060,208	V153M	possibly damaging	Het
Olfr98	A	G	17: 37,263,185	F160L	probably benign	Het
Parvg	T	C	15: 84,331,096		probably null	Het
Peg10	T	A	6: 4,756,591	M389K	unknown	Het
Phf23	G	T	11: 69,999,265	C340F	possibly damaging	Het
Piwil2	A	G	14: 70,374,411	Y929H	probably damaging	Het
Prss39	A	G	1: 34,500,288	D203G	probably damaging	Het
Prss54	G	T	8: 95,559,739	D235E	probably benign	Het
Prtg	T	A	9: 72,907,835	M1015K	possibly damaging	Het
Rbbp8	T	C	18: 11,705,742	I160T	probably damaging	Het
Scn10a	C	A	9: 119,609,724	C1692F	probably damaging	Het
Scn11a	C	T	9: 119,819,833	D55N	probably damaging	Het
Secisbp2	G	T	13: 51,682,462	V768F	probably damaging	Het
Spag16	T	C	1: 70,299,621	I426T	possibly damaging	Het
Sspo	G	A	6: 48,450,077	V250M	possibly damaging	Het
Strbp	A	T	2: 37,641,137		probably null	Het
Sv2c	C	T	13: 96,088,301	V167M	probably damaging	Het
Tdpoz1	G	A	3: 93,670,487	S330L	not run	Het
Tigd2	T	A	6: 59,211,067	D306E	probably benign	Het
Tmem5	A	T	10: 122,088,917	D293E	probably benign	Het
Trrap	C	T	5: 144,845,477	P3278S	possibly damaging	Het
Ttc37	A	G	13: 76,113,579	T138A	probably benign	Het
Vdac1	A	T	11: 52,374,934	K28N	probably damaging	Het
Vmn1r84	A	T	7: 12,362,142	M208K	probably damaging	Het
Vmn2r77	A	T	7: 86,811,310	K615*	probably null	Het
Vps11	A	G	9: 44,354,503	L493P	probably damaging	Het
Zbtb21	T	C	16: 97,952,979	I35V	possibly damaging	Het
Zbtb26	A	T	2: 37,436,655	M123K	possibly damaging	Het
Zfp236	A	T	18: 82,609,345	D1576E	possibly damaging	Het

Other mutations in Nlrp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nlrp3	APN	11	59565943	missense	probably damaging	0.99
IGL00573:Nlrp3	APN	11	59565116	missense	possibly damaging	0.93
IGL01025:Nlrp3	APN	11	59551887	missense	probably benign	0.21
IGL01637:Nlrp3	APN	11	59549378	missense	probably damaging	0.99
IGL02010:Nlrp3	APN	11	59549535	missense	probably benign
IGL02334:Nlrp3	APN	11	59565083	missense	probably benign
IGL02417:Nlrp3	APN	11	59566023	unclassified	probably benign
IGL02578:Nlrp3	APN	11	59548401	missense	probably damaging	1.00
IGL02710:Nlrp3	APN	11	59565976	missense	probably damaging	0.99
IGL02816:Nlrp3	APN	11	59555782	missense	probably benign	0.03
IGL03157:Nlrp3	APN	11	59549546	missense	possibly damaging	0.80
IGL03334:Nlrp3	APN	11	59549016	missense	probably damaging	1.00
Flogiston	UTSW	11	59558448	missense	probably benign	0.00
nd1	UTSW	11	59565974	missense	probably benign	0.45
Nd14	UTSW	11	59555875	missense	possibly damaging	0.89
Nd3	UTSW	11	59565974	missense	probably benign	0.45
nd5	UTSW	11	59565879	missense	probably benign	0.01
nd6	UTSW	11	59549354	missense	probably damaging	1.00
nd7	UTSW	11	59555875	missense	possibly damaging	0.89
Nd9	UTSW	11	59549354	missense	probably damaging	1.00
Park2	UTSW	11	59565128	nonsense	probably null
Park3	UTSW	11	59565850	missense	probably benign	0.02
Park4	UTSW	11	59549531	missense	probably benign	0.19
Park5	UTSW	11	59548476	missense	probably damaging	0.99
Park6	UTSW	11	59549036	missense	probably damaging	1.00
Park7	UTSW	11	59548010	nonsense	probably null
Park8	UTSW	11	59566199	missense	probably benign	0.19
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0052:Nlrp3	UTSW	11	59565128	nonsense	probably null
R0362:Nlrp3	UTSW	11	59548797	missense	possibly damaging	0.49
R0416:Nlrp3	UTSW	11	59555924	splice site	probably benign
R0649:Nlrp3	UTSW	11	59548542	missense	possibly damaging	0.83
R0740:Nlrp3	UTSW	11	59548256	missense	probably benign	0.01
R0863:Nlrp3	UTSW	11	59565850	missense	probably benign	0.02
R1300:Nlrp3	UTSW	11	59555768	missense	possibly damaging	0.86
R1414:Nlrp3	UTSW	11	59549531	missense	probably benign	0.19
R1622:Nlrp3	UTSW	11	59548476	missense	probably damaging	0.99
R1654:Nlrp3	UTSW	11	59543123	missense	probably benign	0.03
R1715:Nlrp3	UTSW	11	59543351	missense	probably damaging	1.00
R1754:Nlrp3	UTSW	11	59558402	missense	possibly damaging	0.80
R1837:Nlrp3	UTSW	11	59548916	missense	probably benign	0.00
R1905:Nlrp3	UTSW	11	59549036	missense	probably damaging	1.00
R2281:Nlrp3	UTSW	11	59549136	missense	possibly damaging	0.70
R4296:Nlrp3	UTSW	11	59549661	missense	possibly damaging	0.89
R4305:Nlrp3	UTSW	11	59548010	nonsense	probably null
R4540:Nlrp3	UTSW	11	59551899	missense	possibly damaging	0.83
R4591:Nlrp3	UTSW	11	59549222	missense	probably benign	0.00
R4816:Nlrp3	UTSW	11	59548301	missense	probably benign	0.32
R4913:Nlrp3	UTSW	11	59549238	missense	probably benign	0.09
R4970:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5051:Nlrp3	UTSW	11	59566199	missense	probably benign	0.19
R5112:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5185:Nlrp3	UTSW	11	59565084	missense	probably benign	0.05
R5417:Nlrp3	UTSW	11	59549063	missense	probably damaging	1.00
R5709:Nlrp3	UTSW	11	59555748	nonsense	probably null
R5869:Nlrp3	UTSW	11	59548134	missense	probably damaging	1.00
R5898:Nlrp3	UTSW	11	59546852	missense	probably benign	0.00
R5953:Nlrp3	UTSW	11	59546791	missense	probably benign
R5979:Nlrp3	UTSW	11	59548971	missense	probably benign	0.06
R6359:Nlrp3	UTSW	11	59548566	missense	probably damaging	0.97
R6723:Nlrp3	UTSW	11	59565192	missense	probably damaging	1.00
R7349:Nlrp3	UTSW	11	59548086	missense	probably damaging	1.00
R7388:Nlrp3	UTSW	11	59565066	missense	probably benign	0.00
R7715:Nlrp3	UTSW	11	59543003	splice site	probably null
R7916:Nlrp3	UTSW	11	59551863	missense	probably benign	0.00
R8222:Nlrp3	UTSW	11	59548788	missense	probably damaging	0.98
R8360:Nlrp3	UTSW	11	59549403	missense	probably benign	0.02
R8390:Nlrp3	UTSW	11	59551790	missense	possibly damaging	0.47
R8550:Nlrp3	UTSW	11	59549271	missense	probably damaging	1.00
R8738:Nlrp3	UTSW	11	59549390	missense	probably benign	0.00
R8940:Nlrp3	UTSW	11	59565044	missense	probably benign	0.26
R8990:Nlrp3	UTSW	11	59548758	missense	probably damaging	0.99
R9324:Nlrp3	UTSW	11	59543315	missense	probably damaging	1.00
R9673:Nlrp3	UTSW	11	59549322	missense	probably damaging	1.00
RF031:Nlrp3	UTSW	11	59558552	frame shift	probably null
RF040:Nlrp3	UTSW	11	59558552	frame shift	probably null
Z1088:Nlrp3	UTSW	11	59551860	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- GCATCGGGAAAACCATCCTAGC -3'
(R):5'- AGGAGATGCTGCAGTTTCTC -3'

Sequencing Primer
(F):5'- CCTAGCCAGGAAGATTATGTTGGAC -3'
(R):5'- CCTCGTCGTTATGAGCAGAGAG -3'

Posted On

2019-06-26