Incidental Mutation 'R7261:Nlrp3'
ID 564642
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 045387-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7261 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 59439272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 283 (V283G)
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect possibly damaging
Transcript: ENSMUST00000079476
AA Change: V283G

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: V283G

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101148
AA Change: V283G

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: V283G

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,259,526 (GRCm39) F1954L probably damaging Het
Acmsd T G 1: 127,687,561 (GRCm39) I281R probably damaging Het
Adamts2 A T 11: 50,677,424 (GRCm39) M742L possibly damaging Het
Adgrf4 G A 17: 42,978,326 (GRCm39) T339I probably benign Het
Aff1 T C 5: 103,976,245 (GRCm39) S448P probably damaging Het
Agbl2 A T 2: 90,619,288 (GRCm39) S38C possibly damaging Het
Akap7 C T 10: 25,147,416 (GRCm39) D105N possibly damaging Het
Arhgap21 A G 2: 20,885,177 (GRCm39) F677L probably benign Het
Atf6b G T 17: 34,869,792 (GRCm39) V271F probably damaging Het
B3gnt5 A G 16: 19,588,123 (GRCm39) Y114C probably damaging Het
Casp7 T A 19: 56,424,765 (GRCm39) D161E probably benign Het
Catsper4 TTCTC TTC 4: 133,954,423 (GRCm39) probably null Het
Ccdc162 T C 10: 41,437,136 (GRCm39) T1758A probably benign Het
Cfap74 C A 4: 155,549,831 (GRCm39) P155T unknown Het
Champ1 A G 8: 13,928,517 (GRCm39) D225G possibly damaging Het
Chrng A T 1: 87,134,962 (GRCm39) probably null Het
Cnksr1 T C 4: 133,963,084 (GRCm39) probably null Het
Col15a1 G A 4: 47,269,088 (GRCm39) G582D probably benign Het
Cwc25 A G 11: 97,648,585 (GRCm39) V81A possibly damaging Het
Ddhd1 A G 14: 45,894,688 (GRCm39) Y261H probably damaging Het
Defa29 A G 8: 21,816,818 (GRCm39) probably null Het
Diaph3 A C 14: 87,202,893 (GRCm39) C666G probably benign Het
Dlx2 A G 2: 71,375,019 (GRCm39) Y282H probably damaging Het
Dsc3 A T 18: 20,113,814 (GRCm39) Y369* probably null Het
Dtwd1 A G 2: 126,000,424 (GRCm39) N120S probably benign Het
Dysf G A 6: 84,169,992 (GRCm39) S1761N probably damaging Het
Enthd1 A T 15: 80,444,416 (GRCm39) N46K probably damaging Het
Epha7 T A 4: 28,813,418 (GRCm39) I12N probably benign Het
Fam171a2 T A 11: 102,328,900 (GRCm39) N620Y probably damaging Het
Garin4 T C 1: 190,896,308 (GRCm39) S112G unknown Het
Gfpt2 A T 11: 49,714,078 (GRCm39) E278D possibly damaging Het
Gm3285 A G 10: 77,698,244 (GRCm39) Q131R unknown Het
Gpcpd1 A C 2: 132,410,619 (GRCm39) C23G probably damaging Het
Gtpbp4 A T 13: 9,037,954 (GRCm39) H228Q probably benign Het
Hdac7 A G 15: 97,704,415 (GRCm39) V500A probably benign Het
Hykk T G 9: 54,828,010 (GRCm39) M83R possibly damaging Het
Idi1 A G 13: 8,936,931 (GRCm39) I101V probably benign Het
Irs2 A T 8: 11,057,018 (GRCm39) H471Q possibly damaging Het
Itsn1 T C 16: 91,702,194 (GRCm39) V12A probably benign Het
Jak2 A G 19: 29,288,385 (GRCm39) I1079V possibly damaging Het
Kcnt2 G A 1: 140,282,255 (GRCm39) R80H possibly damaging Het
Lamb2 T C 9: 108,358,496 (GRCm39) Y178H probably damaging Het
Lgr5 A T 10: 115,423,370 (GRCm39) L10Q possibly damaging Het
Lnx1 G T 5: 74,838,175 (GRCm39) S29* probably null Het
Lpcat3 T A 6: 124,675,050 (GRCm39) F57I probably benign Het
Manf T C 9: 106,769,088 (GRCm39) T4A probably benign Het
Map2k3 G A 11: 60,836,393 (GRCm39) probably null Het
Myh14 G A 7: 44,273,761 (GRCm39) Q1329* probably null Het
Myocd T C 11: 65,078,422 (GRCm39) S458G probably damaging Het
Ncor2 T C 5: 125,187,143 (GRCm39) probably null Het
Ndufs8 A T 19: 3,961,606 (GRCm39) N23K probably benign Het
Nkx6-1 T C 5: 101,812,006 (GRCm39) K32R unknown Het
Nme3 A G 17: 25,116,037 (GRCm39) probably null Het
Or1o3 A G 17: 37,574,076 (GRCm39) F160L probably benign Het
Or8g23 C T 9: 38,971,504 (GRCm39) V153M possibly damaging Het
Parvg T C 15: 84,215,297 (GRCm39) probably null Het
Peg10 T A 6: 4,756,591 (GRCm39) M389K unknown Het
Phf23 G T 11: 69,890,091 (GRCm39) C340F possibly damaging Het
Piwil2 A G 14: 70,611,860 (GRCm39) Y929H probably damaging Het
Prss39 A G 1: 34,539,369 (GRCm39) D203G probably damaging Het
Prss54 G T 8: 96,286,367 (GRCm39) D235E probably benign Het
Prtg T A 9: 72,815,117 (GRCm39) M1015K possibly damaging Het
Rbbp8 T C 18: 11,838,799 (GRCm39) I160T probably damaging Het
Rxylt1 A T 10: 121,924,822 (GRCm39) D293E probably benign Het
Scn10a C A 9: 119,438,790 (GRCm39) C1692F probably damaging Het
Scn11a C T 9: 119,648,899 (GRCm39) D55N probably damaging Het
Secisbp2 G T 13: 51,836,498 (GRCm39) V768F probably damaging Het
Skic3 A G 13: 76,261,698 (GRCm39) T138A probably benign Het
Spag16 T C 1: 70,338,780 (GRCm39) I426T possibly damaging Het
Sspo G A 6: 48,427,011 (GRCm39) V250M possibly damaging Het
Strbp A T 2: 37,531,149 (GRCm39) probably null Het
Sv2c C T 13: 96,224,809 (GRCm39) V167M probably damaging Het
Tdpoz1 G A 3: 93,577,794 (GRCm39) S330L not run Het
Tigd2 T A 6: 59,188,052 (GRCm39) D306E probably benign Het
Trrap C T 5: 144,782,287 (GRCm39) P3278S possibly damaging Het
Vdac1 A T 11: 52,265,761 (GRCm39) K28N probably damaging Het
Vmn1r84 A T 7: 12,096,069 (GRCm39) M208K probably damaging Het
Vmn2r77 A T 7: 86,460,518 (GRCm39) K615* probably null Het
Vps11 A G 9: 44,265,800 (GRCm39) L493P probably damaging Het
Zbtb21 T C 16: 97,754,179 (GRCm39) I35V possibly damaging Het
Zbtb26 A T 2: 37,326,667 (GRCm39) M123K possibly damaging Het
Zfp236 A T 18: 82,627,470 (GRCm39) D1576E possibly damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCATCGGGAAAACCATCCTAGC -3'
(R):5'- AGGAGATGCTGCAGTTTCTC -3'

Sequencing Primer
(F):5'- CCTAGCCAGGAAGATTATGTTGGAC -3'
(R):5'- CCTCGTCGTTATGAGCAGAGAG -3'
Posted On 2019-06-26