Incidental Mutation 'R7261:Phf23'
ID564644
Institutional Source Beutler Lab
Gene Symbol Phf23
Ensembl Gene ENSMUSG00000018572
Gene NamePHD finger protein 23
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7261 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69995777-70000009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69999265 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 340 (C340F)
Ref Sequence ENSEMBL: ENSMUSP00000018716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018711] [ENSMUST00000018716] [ENSMUST00000019362] [ENSMUST00000101526] [ENSMUST00000102575] [ENSMUST00000108592] [ENSMUST00000133485] [ENSMUST00000135814] [ENSMUST00000138186] [ENSMUST00000153684] [ENSMUST00000190940]
Predicted Effect probably benign
Transcript: ENSMUST00000018711
SMART Domains Protein: ENSMUSP00000018711
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 116 1.8e-51 PFAM
Pfam:APG12 30 116 6.2e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000018716
AA Change: C340F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018716
Gene: ENSMUSG00000018572
AA Change: C340F

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 188 196 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 225 241 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 263 286 N/A INTRINSIC
PHD 339 383 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019362
SMART Domains Protein: ENSMUSP00000019362
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
Pfam:Dishevelled 103 263 1.5e-60 PFAM
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.1e-75 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000101526
AA Change: C273F
SMART Domains Protein: ENSMUSP00000099064
Gene: ENSMUSG00000018572
AA Change: C273F

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 158 174 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 196 219 N/A INTRINSIC
PHD 272 316 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102575
SMART Domains Protein: ENSMUSP00000099635
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108592
SMART Domains Protein: ENSMUSP00000104233
Gene: ENSMUSG00000018567

DomainStartEndE-ValueType
Pfam:Atg8 13 93 5.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133485
AA Change: C210F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117373
Gene: ENSMUSG00000018572
AA Change: C210F

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135814
AA Change: C210F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120665
Gene: ENSMUSG00000018572
AA Change: C210F

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138186
SMART Domains Protein: ENSMUSP00000117635
Gene: ENSMUSG00000018572

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 178 186 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153684
AA Change: C210F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121780
Gene: ENSMUSG00000018572
AA Change: C210F

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 58 66 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 117 131 N/A INTRINSIC
low complexity region 133 156 N/A INTRINSIC
PHD 209 253 1.2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190940
SMART Domains Protein: ENSMUSP00000140073
Gene: ENSMUSG00000020888

DomainStartEndE-ValueType
DAX 11 93 2.31e-56 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Dishevelled 160 232 8.1e-27 PFAM
low complexity region 250 262 N/A INTRINSIC
PDZ 276 355 1.65e-15 SMART
low complexity region 395 407 N/A INTRINSIC
DEP 433 507 6.6e-29 SMART
Pfam:Dsh_C 515 726 1.3e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Chrng A T 1: 87,207,240 probably null Het
Cnksr1 T C 4: 134,235,773 probably null Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Map2k3 G A 11: 60,945,567 probably null Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ncor2 T C 5: 125,110,079 probably null Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Nme3 A G 17: 24,897,063 probably null Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Strbp A T 2: 37,641,137 probably null Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Phf23
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7359:Phf23 UTSW 11 69998641 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGATGCTAGCTCCAGTGAAGG -3'
(R):5'- GTTCCAGCCTTAGTGATGTCAG -3'

Sequencing Primer
(F):5'- CTCCAGTGAAGGCGAGATGC -3'
(R):5'- CCAGCCTTAGTGATGTCAGGGTTC -3'
Posted On2019-06-26