Incidental Mutation 'R7261:B3gnt5'
ID564659
Institutional Source Beutler Lab
Gene Symbol B3gnt5
Ensembl Gene ENSMUSG00000022686
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R7261 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location19760208-19772753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19769373 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 114 (Y114C)
Ref Sequence ENSEMBL: ENSMUSP00000078712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]
Predicted Effect probably damaging
Transcript: ENSMUST00000079780
AA Change: Y114C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: Y114C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119468
AA Change: Y114C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: Y114C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121344
AA Change: Y114C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: Y114C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164397
AA Change: Y114C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: Y114C

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
Atf6b G T 17: 34,650,818 V271F probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Chrng A T 1: 87,207,240 probably null Het
Cnksr1 T C 4: 134,235,773 probably null Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Map2k3 G A 11: 60,945,567 probably null Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ncor2 T C 5: 125,110,079 probably null Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Nme3 A G 17: 24,897,063 probably null Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Strbp A T 2: 37,641,137 probably null Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in B3gnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:B3gnt5 APN 16 19769213 missense probably damaging 1.00
IGL01503:B3gnt5 APN 16 19769781 missense probably damaging 1.00
IGL02623:B3gnt5 APN 16 19769610 missense probably damaging 1.00
IGL02978:B3gnt5 APN 16 19769994 missense probably damaging 1.00
IGL03355:B3gnt5 APN 16 19769153 missense probably benign 0.01
IGL03388:B3gnt5 APN 16 19770051 missense possibly damaging 0.83
R0180:B3gnt5 UTSW 16 19769100 missense possibly damaging 0.48
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0974:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R1034:B3gnt5 UTSW 16 19769484 missense probably damaging 1.00
R1435:B3gnt5 UTSW 16 19769174 missense probably damaging 0.99
R1480:B3gnt5 UTSW 16 19769867 missense probably damaging 1.00
R1533:B3gnt5 UTSW 16 19769614 missense probably damaging 1.00
R1920:B3gnt5 UTSW 16 19769544 missense probably benign 0.34
R3962:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R3963:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R4620:B3gnt5 UTSW 16 19769882 missense probably benign 0.37
R4948:B3gnt5 UTSW 16 19769144 missense probably benign
R4987:B3gnt5 UTSW 16 19769202 missense probably damaging 1.00
R5027:B3gnt5 UTSW 16 19769694 missense probably damaging 1.00
R6415:B3gnt5 UTSW 16 19770009 missense probably damaging 1.00
R7027:B3gnt5 UTSW 16 19769990 missense probably damaging 1.00
R7224:B3gnt5 UTSW 16 19769753 missense probably benign 0.06
R7369:B3gnt5 UTSW 16 19769660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATACCTCGTAAATAGCTATGGC -3'
(R):5'- AGGTATTTGCCCAGCTGAAC -3'

Sequencing Primer
(F):5'- GCTATGGCTTTGTAAACAATTCCCTG -3'
(R):5'- GCTGAACTGAAGAAGGAATTTAGAAG -3'
Posted On2019-06-26