Incidental Mutation 'R0582:Ears2'
ID56466
Institutional Source Beutler Lab
Gene Symbol Ears2
Ensembl Gene ENSMUSG00000030871
Gene Nameglutamyl-tRNA synthetase 2, mitochondrial
Synonyms3230401I01Rik
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0582 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122037213-122067263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122055658 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 129 (E129G)
Ref Sequence ENSEMBL: ENSMUSP00000033159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033159]
Predicted Effect probably benign
Transcript: ENSMUST00000033159
AA Change: E129G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033159
Gene: ENSMUSG00000030871
AA Change: E129G

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 36 353 3.5e-88 PFAM
low complexity region 448 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151530
Meta Mutation Damage Score 0.2846 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of glutamate to tRNA molecules. Mutations in a similar gene in human have been associated with combined oxidative phosphorylation deficiency 12 (COXPD12). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Ears2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ears2 APN 7 122039762 nonsense probably null
IGL00870:Ears2 APN 7 122055676 missense probably damaging 1.00
IGL01434:Ears2 APN 7 122063088 splice site probably benign
IGL01676:Ears2 APN 7 122044558 missense probably benign
IGL02341:Ears2 APN 7 122039764 missense probably benign
IGL02355:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02362:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02932:Ears2 APN 7 122063061 missense probably damaging 1.00
PIT4453001:Ears2 UTSW 7 122048339 missense probably benign 0.04
R0555:Ears2 UTSW 7 122048444 missense probably benign 0.22
R0588:Ears2 UTSW 7 122044291 splice site probably benign
R0733:Ears2 UTSW 7 122048129 missense possibly damaging 0.83
R1316:Ears2 UTSW 7 122046682 missense probably benign 0.00
R1916:Ears2 UTSW 7 122044578 missense probably benign 0.01
R2862:Ears2 UTSW 7 122062940 missense probably damaging 1.00
R4634:Ears2 UTSW 7 122044609 missense probably benign 0.00
R4686:Ears2 UTSW 7 122048204 missense probably damaging 1.00
R5177:Ears2 UTSW 7 122044460 intron probably benign
R5275:Ears2 UTSW 7 122048198 missense probably damaging 1.00
R5295:Ears2 UTSW 7 122048198 missense probably damaging 1.00
R5385:Ears2 UTSW 7 122044377 missense probably benign 0.36
R5386:Ears2 UTSW 7 122044377 missense probably benign 0.36
R6510:Ears2 UTSW 7 122062994 missense probably damaging 1.00
R6894:Ears2 UTSW 7 122048224 missense probably damaging 1.00
R7828:Ears2 UTSW 7 122048340 missense probably benign
Z1176:Ears2 UTSW 7 122044581 missense probably damaging 0.98
Z1176:Ears2 UTSW 7 122055710 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGTTAGAGAAAACCCATGTGACAAGGA -3'
(R):5'- CCAGACATAGTAAAACCCGTTCCATTCC -3'

Sequencing Primer
(F):5'- gaggaggggacagaaggg -3'
(R):5'- atctgaaatgaaatctgacgcc -3'
Posted On2013-07-11