Incidental Mutation 'R7261:Atf6b'
ID564662
Institutional Source Beutler Lab
Gene Symbol Atf6b
Ensembl Gene ENSMUSG00000015461
Gene Nameactivating transcription factor 6 beta
SynonymsCreb-rp, ATF6beta, Crebl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R7261 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34647146-34655074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34650818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 271 (V271F)
Ref Sequence ENSEMBL: ENSMUSP00000015605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614]
Predicted Effect probably damaging
Transcript: ENSMUST00000015605
AA Change: V271F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461
AA Change: V271F

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036720
SMART Domains Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739

DomainStartEndE-ValueType
TPR 208 241 2.92e1 SMART
TPR 250 283 4.77e-2 SMART
TPR 284 317 1.89e-5 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461
AA Change: V274F

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Meta Mutation Damage Score 0.1239 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor in the unfolded protein response (UPR) pathway during ER stress. Either as a homodimer or as a heterodimer with ATF6-alpha, the encoded protein binds to the ER stress response element, interacting with nuclear transcription factor Y to activate UPR target genes. The protein is normally found in the membrane of the endoplasmic reticulum; however, under ER stress, the N-terminal cytoplasmic domain is cleaved from the rest of the protein and translocates to the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased cellular sensitivity to thapsigargin and tunicamycin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,368,700 F1954L probably damaging Het
Acmsd T G 1: 127,759,824 I281R probably damaging Het
Adamts2 A T 11: 50,786,597 M742L possibly damaging Het
Adgrf4 G A 17: 42,667,435 T339I probably benign Het
Aff1 T C 5: 103,828,379 S448P probably damaging Het
Agbl2 A T 2: 90,788,944 S38C possibly damaging Het
Akap7 C T 10: 25,271,518 D105N possibly damaging Het
Arhgap21 A G 2: 20,880,366 F677L probably benign Het
B3gnt5 A G 16: 19,769,373 Y114C probably damaging Het
Casp7 T A 19: 56,436,333 D161E probably benign Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc162 T C 10: 41,561,140 T1758A probably benign Het
Cfap74 C A 4: 155,465,374 P155T unknown Het
Champ1 A G 8: 13,878,517 D225G possibly damaging Het
Chrng A T 1: 87,207,240 probably null Het
Cnksr1 T C 4: 134,235,773 probably null Het
Col15a1 G A 4: 47,269,088 G582D probably benign Het
Cwc25 A G 11: 97,757,759 V81A possibly damaging Het
Ddhd1 A G 14: 45,657,231 Y261H probably damaging Het
Defa29 A G 8: 21,326,802 probably null Het
Diaph3 A C 14: 86,965,457 C666G probably benign Het
Dlx2 A G 2: 71,544,675 Y282H probably damaging Het
Dsc3 A T 18: 19,980,757 Y369* probably null Het
Dtwd1 A G 2: 126,158,504 N120S probably benign Het
Dysf G A 6: 84,193,010 S1761N probably damaging Het
Enthd1 A T 15: 80,560,215 N46K probably damaging Het
Epha7 T A 4: 28,813,418 I12N probably benign Het
Fam171a2 T A 11: 102,438,074 N620Y probably damaging Het
Fam71a T C 1: 191,164,111 S112G unknown Het
Gfpt2 A T 11: 49,823,251 E278D possibly damaging Het
Gm3285 A G 10: 77,862,410 Q131R unknown Het
Gpcpd1 A C 2: 132,568,699 C23G probably damaging Het
Gtpbp4 A T 13: 8,987,918 H228Q probably benign Het
Hdac7 A G 15: 97,806,534 V500A probably benign Het
Hykk T G 9: 54,920,726 M83R possibly damaging Het
Idi1 A G 13: 8,886,895 I101V probably benign Het
Irs2 A T 8: 11,007,018 H471Q possibly damaging Het
Itsn1 T C 16: 91,905,306 V12A probably benign Het
Jak2 A G 19: 29,310,985 I1079V possibly damaging Het
Kcnt2 G A 1: 140,354,517 R80H possibly damaging Het
Lamb2 T C 9: 108,481,297 Y178H probably damaging Het
Lgr5 A T 10: 115,587,465 L10Q possibly damaging Het
Lnx1 G T 5: 74,677,514 S29* probably null Het
Lpcat3 T A 6: 124,698,087 F57I probably benign Het
Manf T C 9: 106,891,889 T4A probably benign Het
Map2k3 G A 11: 60,945,567 probably null Het
Myh14 G A 7: 44,624,337 Q1329* probably null Het
Myocd T C 11: 65,187,596 S458G probably damaging Het
Ncor2 T C 5: 125,110,079 probably null Het
Ndufs8 A T 19: 3,911,606 N23K probably benign Het
Nkx6-1 T C 5: 101,664,140 K32R unknown Het
Nlrp3 T G 11: 59,548,446 V283G possibly damaging Het
Nme3 A G 17: 24,897,063 probably null Het
Olfr937 C T 9: 39,060,208 V153M possibly damaging Het
Olfr98 A G 17: 37,263,185 F160L probably benign Het
Parvg T C 15: 84,331,096 probably null Het
Peg10 T A 6: 4,756,591 M389K unknown Het
Phf23 G T 11: 69,999,265 C340F possibly damaging Het
Piwil2 A G 14: 70,374,411 Y929H probably damaging Het
Prss39 A G 1: 34,500,288 D203G probably damaging Het
Prss54 G T 8: 95,559,739 D235E probably benign Het
Prtg T A 9: 72,907,835 M1015K possibly damaging Het
Rbbp8 T C 18: 11,705,742 I160T probably damaging Het
Scn10a C A 9: 119,609,724 C1692F probably damaging Het
Scn11a C T 9: 119,819,833 D55N probably damaging Het
Secisbp2 G T 13: 51,682,462 V768F probably damaging Het
Spag16 T C 1: 70,299,621 I426T possibly damaging Het
Sspo G A 6: 48,450,077 V250M possibly damaging Het
Strbp A T 2: 37,641,137 probably null Het
Sv2c C T 13: 96,088,301 V167M probably damaging Het
Tdpoz1 G A 3: 93,670,487 S330L not run Het
Tigd2 T A 6: 59,211,067 D306E probably benign Het
Tmem5 A T 10: 122,088,917 D293E probably benign Het
Trrap C T 5: 144,845,477 P3278S possibly damaging Het
Ttc37 A G 13: 76,113,579 T138A probably benign Het
Vdac1 A T 11: 52,374,934 K28N probably damaging Het
Vmn1r84 A T 7: 12,362,142 M208K probably damaging Het
Vmn2r77 A T 7: 86,811,310 K615* probably null Het
Vps11 A G 9: 44,354,503 L493P probably damaging Het
Zbtb21 T C 16: 97,952,979 I35V possibly damaging Het
Zbtb26 A T 2: 37,436,655 M123K possibly damaging Het
Zfp236 A T 18: 82,609,345 D1576E possibly damaging Het
Other mutations in Atf6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Atf6b APN 17 34649137 missense probably damaging 0.99
IGL02010:Atf6b APN 17 34654652 missense probably benign 0.00
IGL02023:Atf6b APN 17 34651867 missense possibly damaging 0.93
IGL02141:Atf6b APN 17 34653277 missense probably benign 0.01
IGL02511:Atf6b APN 17 34654641 missense probably benign 0.01
IGL03347:Atf6b APN 17 34653240 missense probably damaging 1.00
R0112:Atf6b UTSW 17 34651626 missense probably damaging 0.97
R0285:Atf6b UTSW 17 34650396 unclassified probably benign
R0544:Atf6b UTSW 17 34648299 critical splice donor site probably null
R1618:Atf6b UTSW 17 34647728 nonsense probably null
R1689:Atf6b UTSW 17 34650302 missense probably damaging 0.98
R1823:Atf6b UTSW 17 34648644 missense possibly damaging 0.48
R1996:Atf6b UTSW 17 34652987 critical splice acceptor site probably null
R2057:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2058:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R2059:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R4290:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4291:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4293:Atf6b UTSW 17 34652674 missense probably benign 0.00
R4880:Atf6b UTSW 17 34654555 missense probably damaging 1.00
R4893:Atf6b UTSW 17 34648612 missense probably damaging 1.00
R5406:Atf6b UTSW 17 34653797 nonsense probably null
R5549:Atf6b UTSW 17 34651683 missense probably damaging 1.00
R5702:Atf6b UTSW 17 34651004 missense possibly damaging 0.93
R6386:Atf6b UTSW 17 34651851 missense probably damaging 0.97
R6833:Atf6b UTSW 17 34649157 missense probably damaging 1.00
R6834:Atf6b UTSW 17 34649157 missense probably damaging 1.00
R7094:Atf6b UTSW 17 34653816 critical splice donor site probably null
R7205:Atf6b UTSW 17 34653729 missense probably damaging 1.00
R7969:Atf6b UTSW 17 34648575 critical splice acceptor site probably null
R8103:Atf6b UTSW 17 34653975 missense probably damaging 1.00
R8179:Atf6b UTSW 17 34653994 missense probably damaging 0.99
R8355:Atf6b UTSW 17 34648223 missense probably benign 0.01
R8455:Atf6b UTSW 17 34648223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGATAGTTCCTCAGGTAATGGG -3'
(R):5'- CTCGGATAGCACCTTGGATG -3'

Sequencing Primer
(F):5'- CTCAGGTAATGGGGTCTCCTGAC -3'
(R):5'- TAGCACCTTGGATGAGGACCAC -3'
Posted On2019-06-26