Incidental Mutation 'R7262:Kif26b'
ID564673
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178917654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1772 (S1772P)
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160789
AA Change: S1325P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494
AA Change: S1325P

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161017
AA Change: S1772P

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494
AA Change: S1772P

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3832:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
R7506:Kif26b UTSW 1 178529499 start gained probably benign
R7562:Kif26b UTSW 1 178914976 missense probably damaging 1.00
R7583:Kif26b UTSW 1 178530445 nonsense probably null
R7585:Kif26b UTSW 1 178916496 missense probably benign 0.01
R7644:Kif26b UTSW 1 178679274 missense probably benign 0.04
R7759:Kif26b UTSW 1 178678944 missense probably damaging 1.00
R7775:Kif26b UTSW 1 178864876 missense probably benign 0.15
R8012:Kif26b UTSW 1 178916250 missense probably benign 0.20
R8152:Kif26b UTSW 1 178679229 missense possibly damaging 0.46
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Z1177:Kif26b UTSW 1 178821548 missense probably benign 0.11
Z1177:Kif26b UTSW 1 178821550 nonsense probably null
Z1177:Kif26b UTSW 1 178915405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAAAGATAGTACCATGCCC -3'
(R):5'- TGTTATCACTACCGTGCCCG -3'

Sequencing Primer
(F):5'- TAGTACCATGCCCCGCACTG -3'
(R):5'- CTTCCTCGGAGGGGTGATC -3'
Posted On2019-06-26