Incidental Mutation 'R7262:Olfr1310'
ID564674
Institutional Source Beutler Lab
Gene Symbol Olfr1310
Ensembl Gene ENSMUSG00000108827
Gene Nameolfactory receptor 1310
SynonymsGA_x6K02T2Q125-73056609-73055671, MOR245-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112004574-112012708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112008557 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 210 (S210P)
Ref Sequence ENSEMBL: ENSMUSP00000149701 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000207169
AA Change: S210P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213559
AA Change: S210P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.2567 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Olfr1310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Olfr1310 APN 2 112009016 missense possibly damaging 0.86
IGL02700:Olfr1310 APN 2 112008691 missense probably benign 0.04
IGL03008:Olfr1310 APN 2 112008523 missense possibly damaging 0.95
IGL03121:Olfr1310 APN 2 112008608 missense probably benign 0.02
R0025:Olfr1310 UTSW 2 112009020 missense probably damaging 0.98
R1624:Olfr1310 UTSW 2 112008532 missense probably damaging 1.00
R1851:Olfr1310 UTSW 2 112008691 missense probably benign 0.04
R3872:Olfr1310 UTSW 2 112008323 missense possibly damaging 0.95
R3873:Olfr1310 UTSW 2 112008323 missense possibly damaging 0.95
R3874:Olfr1310 UTSW 2 112008323 missense possibly damaging 0.95
R4651:Olfr1310 UTSW 2 112008250 missense probably damaging 1.00
R4652:Olfr1310 UTSW 2 112008250 missense probably damaging 1.00
R4834:Olfr1310 UTSW 2 112008931 missense probably damaging 1.00
R5076:Olfr1310 UTSW 2 112008592 missense probably damaging 0.99
R7339:Olfr1310 UTSW 2 112008475 missense probably damaging 1.00
R7657:Olfr1310 UTSW 2 112008748 missense probably benign 0.02
R7798:Olfr1310 UTSW 2 112008272 missense probably benign
R7875:Olfr1310 UTSW 2 112008847 missense probably benign 0.32
X0027:Olfr1310 UTSW 2 112008824 missense probably damaging 1.00
Z1176:Olfr1310 UTSW 2 112008457 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGATGTGATGTTGGAAATGGC -3'
(R):5'- CTACCTGACCATCATGAGCC -3'

Sequencing Primer
(F):5'- GATGTTGGAAATGGCCATGTATAG -3'
(R):5'- GGATTATTGGCTTCATCCACTCAGTG -3'
Posted On2019-06-26