Incidental Mutation 'R0582:Atp11a'
ID56468
Institutional Source Beutler Lab
Gene Symbol Atp11a
Ensembl Gene ENSMUSG00000031441
Gene NameATPase, class VI, type 11A
SynonymsIh, 4930558F19Rik
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0582 (G1)
Quality Score212
Status Validated
Chromosome8
Chromosomal Location12757014-12868728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12831214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 451 (S451P)
Ref Sequence ENSEMBL: ENSMUSP00000033818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033818] [ENSMUST00000091237] [ENSMUST00000132974] [ENSMUST00000133338]
Predicted Effect probably benign
Transcript: ENSMUST00000033818
AA Change: S451P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033818
Gene: ENSMUSG00000031441
AA Change: S451P

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 3.6e-26 PFAM
Pfam:E1-E2_ATPase 101 377 1.1e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 9.9e-21 PFAM
Pfam:Cation_ATPase 476 589 2.5e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091237
AA Change: S451P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088779
Gene: ENSMUSG00000031441
AA Change: S451P

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 7.3e-26 PFAM
Pfam:E1-E2_ATPase 101 377 2.7e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 1.9e-20 PFAM
Pfam:Cation_ATPase 476 589 7.4e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 4.5e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127197
Predicted Effect probably benign
Transcript: ENSMUST00000132974
SMART Domains Protein: ENSMUSP00000117091
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 42 2.6e-8 PFAM
Pfam:HAD 17 290 4.1e-14 PFAM
Pfam:Hydrolase 20 293 7.7e-13 PFAM
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133338
SMART Domains Protein: ENSMUSP00000120625
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 99 291 7.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147398
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Atp11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Atp11a APN 8 12844609 missense probably damaging 1.00
IGL01397:Atp11a APN 8 12812321 missense probably damaging 1.00
IGL01712:Atp11a APN 8 12851138 missense probably benign 0.11
IGL02113:Atp11a APN 8 12865048 missense probably benign
IGL02449:Atp11a APN 8 12757358 splice site probably null
IGL02550:Atp11a APN 8 12816997 missense possibly damaging 0.72
IGL03099:Atp11a APN 8 12827462 missense possibly damaging 0.52
R0139:Atp11a UTSW 8 12846054 missense probably benign 0.00
R0265:Atp11a UTSW 8 12856930 splice site probably benign
R0294:Atp11a UTSW 8 12827524 missense probably benign 0.03
R0331:Atp11a UTSW 8 12816953 nonsense probably null
R1033:Atp11a UTSW 8 12828555 missense probably damaging 1.00
R1213:Atp11a UTSW 8 12842859 missense probably benign 0.04
R1551:Atp11a UTSW 8 12812340 missense probably damaging 1.00
R1648:Atp11a UTSW 8 12847495 missense probably damaging 1.00
R1752:Atp11a UTSW 8 12813094 missense probably damaging 1.00
R1826:Atp11a UTSW 8 12846154 missense probably damaging 1.00
R1887:Atp11a UTSW 8 12812324 missense probably damaging 1.00
R2079:Atp11a UTSW 8 12857902 missense probably damaging 1.00
R2106:Atp11a UTSW 8 12835228 missense probably benign
R2319:Atp11a UTSW 8 12847505 missense probably damaging 1.00
R2966:Atp11a UTSW 8 12847853 unclassified probably null
R4021:Atp11a UTSW 8 12842938 missense probably benign 0.01
R4183:Atp11a UTSW 8 12816990 missense possibly damaging 0.94
R4640:Atp11a UTSW 8 12828434 splice site probably benign
R4705:Atp11a UTSW 8 12813118 missense probably damaging 1.00
R5354:Atp11a UTSW 8 12806753 missense probably damaging 1.00
R5777:Atp11a UTSW 8 12832522 missense probably damaging 0.99
R6152:Atp11a UTSW 8 12846100 missense probably damaging 0.97
R6171:Atp11a UTSW 8 12832663 missense probably damaging 1.00
R6197:Atp11a UTSW 8 12846099 missense probably benign 0.01
R6335:Atp11a UTSW 8 12859481 critical splice donor site probably null
R6526:Atp11a UTSW 8 12864999 missense probably benign
R6792:Atp11a UTSW 8 12861939 unclassified probably benign
R6923:Atp11a UTSW 8 12856949 missense probably damaging 0.99
R6959:Atp11a UTSW 8 12820467 missense probably damaging 1.00
R7297:Atp11a UTSW 8 12806774 critical splice donor site probably null
R7499:Atp11a UTSW 8 12832575 missense probably benign 0.01
R7606:Atp11a UTSW 8 12844427 missense probably damaging 1.00
R7844:Atp11a UTSW 8 12851039 missense possibly damaging 0.68
R7927:Atp11a UTSW 8 12851039 missense possibly damaging 0.68
R8099:Atp11a UTSW 8 12861973 missense
X0017:Atp11a UTSW 8 12826323 critical splice acceptor site probably null
X0022:Atp11a UTSW 8 12847794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGACTCAGAAATTCCTGTCCCAC -3'
(R):5'- GAATCACTGTCAAGACCTCCTGCC -3'

Sequencing Primer
(F):5'- CTGTCCCACTAGGGTTGTAATAGAC -3'
(R):5'- CCCTTGGAAGGGGACACAG -3'
Posted On2013-07-11