Incidental Mutation 'R7262:Tcaf3'
ID 564684
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7262 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 42593801 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 339 (L339P)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably damaging
Transcript: ENSMUST00000069023
AA Change: L339P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: L339P

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42596782 missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42596972 nonsense probably null
R9469:Tcaf3 UTSW 6 42596894 missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGAAAGTGATAGTTTGTCCCTTC -3'
(R):5'- TGCTGCCATTTGTGCTTAATGC -3'

Sequencing Primer
(F):5'- AATGGGAAACTGCCTCGCTG -3'
(R):5'- CTTTACACTGGCTGATGGGGAAC -3'
Posted On 2019-06-26