Incidental Mutation 'R7262:Olfr600'
ID564688
Institutional Source Beutler Lab
Gene Symbol Olfr600
Ensembl Gene ENSMUSG00000045540
Gene Nameolfactory receptor 600
SynonymsGA_x6K02T2PBJ9-6056235-6055291, MOR39-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103343482-103349669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103346557 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 124 (R124G)
Ref Sequence ENSEMBL: ENSMUSP00000148967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056222] [ENSMUST00000215042]
Predicted Effect probably damaging
Transcript: ENSMUST00000056222
AA Change: R124G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053887
Gene: ENSMUSG00000045540
AA Change: R124G

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.1e-97 PFAM
Pfam:7TM_GPCR_Srsx 37 226 1.2e-12 PFAM
Pfam:7tm_1 43 305 7.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215042
AA Change: R124G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Olfr600
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr600 APN 7 103346179 missense probably benign 0.15
IGL02239:Olfr600 APN 7 103346598 missense probably damaging 1.00
IGL02285:Olfr600 APN 7 103346038 nonsense probably null
IGL02547:Olfr600 APN 7 103346244 missense probably damaging 1.00
IGL03149:Olfr600 APN 7 103346849 missense probably benign 0.00
R0193:Olfr600 UTSW 7 103346204 missense possibly damaging 0.74
R0304:Olfr600 UTSW 7 103346711 missense probably damaging 1.00
R0454:Olfr600 UTSW 7 103346878 missense probably benign 0.02
R0622:Olfr600 UTSW 7 103346857 missense probably damaging 0.97
R1988:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R1989:Olfr600 UTSW 7 103346109 missense possibly damaging 0.88
R2937:Olfr600 UTSW 7 103346065 missense probably benign 0.18
R4426:Olfr600 UTSW 7 103346083 missense probably damaging 1.00
R5362:Olfr600 UTSW 7 103346247 missense probably damaging 1.00
R5723:Olfr600 UTSW 7 103346619 missense possibly damaging 0.85
R6793:Olfr600 UTSW 7 103346266 missense probably benign 0.00
R6863:Olfr600 UTSW 7 103346916 missense possibly damaging 0.86
R6935:Olfr600 UTSW 7 103346795 missense probably damaging 1.00
R6983:Olfr600 UTSW 7 103346815 missense probably benign 0.00
R7313:Olfr600 UTSW 7 103346331 missense probably benign 0.06
R7774:Olfr600 UTSW 7 103346530 missense possibly damaging 0.85
X0018:Olfr600 UTSW 7 103346899 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATGTGGTTGGAGATATCCCCAC -3'
(R):5'- GGCTACACTATCAGTCGTGGAC -3'

Sequencing Primer
(F):5'- TACAGCCATGTACGCACAGTAGG -3'
(R):5'- ACACTATCAGTCGTGGACTTGTGC -3'
Posted On2019-06-26