Incidental Mutation 'R7262:Cdcp1'
ID564692
Institutional Source Beutler Lab
Gene Symbol Cdcp1
Ensembl Gene ENSMUSG00000035498
Gene NameCUB domain containing protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location123170824-123216038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123173615 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 797 (E797G)
Ref Sequence ENSEMBL: ENSMUSP00000042057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039229]
Predicted Effect probably damaging
Transcript: ENSMUST00000039229
AA Change: E797G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042057
Gene: ENSMUSG00000035498
AA Change: E797G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 56 267 1.33e-11 PROSPERO
internal_repeat_1 374 591 1.33e-11 PROSPERO
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Cdcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cdcp1 APN 9 123180001 nonsense probably null
IGL01883:Cdcp1 APN 9 123183598 missense probably benign 0.18
IGL02029:Cdcp1 APN 9 123183834 splice site probably benign
IGL02115:Cdcp1 APN 9 123185397 missense probably damaging 1.00
IGL02516:Cdcp1 APN 9 123173637 missense possibly damaging 0.86
IGL02709:Cdcp1 APN 9 123173814 missense probably damaging 1.00
IGL03263:Cdcp1 APN 9 123180087 missense probably benign 0.12
IGL03406:Cdcp1 APN 9 123185313 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0939:Cdcp1 UTSW 9 123183690 missense probably damaging 1.00
R1411:Cdcp1 UTSW 9 123190112 missense probably damaging 0.99
R1460:Cdcp1 UTSW 9 123180027 missense possibly damaging 0.69
R1538:Cdcp1 UTSW 9 123173588 missense probably damaging 1.00
R1660:Cdcp1 UTSW 9 123185362 missense probably benign 0.09
R1673:Cdcp1 UTSW 9 123178021 nonsense probably null
R1794:Cdcp1 UTSW 9 123190094 missense probably benign 0.37
R1794:Cdcp1 UTSW 9 123215831 missense probably benign
R2472:Cdcp1 UTSW 9 123185107 missense probably benign 0.07
R3961:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R3962:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R4288:Cdcp1 UTSW 9 123183628 missense probably damaging 0.99
R4888:Cdcp1 UTSW 9 123182129 intron probably benign
R4953:Cdcp1 UTSW 9 123180023 missense probably benign 0.00
R5236:Cdcp1 UTSW 9 123185193 missense probably damaging 1.00
R5546:Cdcp1 UTSW 9 123178029 missense probably damaging 1.00
R5848:Cdcp1 UTSW 9 123183705 missense possibly damaging 0.87
R5903:Cdcp1 UTSW 9 123173772 nonsense probably null
R6052:Cdcp1 UTSW 9 123185331 missense probably benign 0.04
R6344:Cdcp1 UTSW 9 123182382 missense possibly damaging 0.69
R6904:Cdcp1 UTSW 9 123173915 missense probably benign
R7038:Cdcp1 UTSW 9 123173597 missense probably damaging 1.00
R7092:Cdcp1 UTSW 9 123183613 missense probably benign 0.20
R7275:Cdcp1 UTSW 9 123185054 missense possibly damaging 0.79
R7294:Cdcp1 UTSW 9 123177921 missense probably benign 0.01
R7373:Cdcp1 UTSW 9 123177900 missense probably damaging 1.00
R7394:Cdcp1 UTSW 9 123173813 missense probably damaging 1.00
R7527:Cdcp1 UTSW 9 123185107 missense probably benign 0.26
R7674:Cdcp1 UTSW 9 123216006 start gained probably benign
R7680:Cdcp1 UTSW 9 123183519 missense probably damaging 1.00
R8079:Cdcp1 UTSW 9 123173790 missense probably damaging 1.00
X0028:Cdcp1 UTSW 9 123185184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCTGACTTCTTGATGGGAC -3'
(R):5'- GTGTATGCTGTCATCGAAGACAC -3'

Sequencing Primer
(F):5'- GGACAGTTCTTCATGTCTCAATG -3'
(R):5'- GCTGTCATCGAAGACACCATGG -3'
Posted On2019-06-26