Incidental Mutation 'R7262:Lama4'
ID564693
Institutional Source Beutler Lab
Gene Symbol Lama4
Ensembl Gene ENSMUSG00000019846
Gene Namelaminin, alpha 4
Synonymslaminin [a]4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location38965515-39110188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39094934 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1498 (H1498Q)
Ref Sequence ENSEMBL: ENSMUSP00000019992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019992]
Predicted Effect probably damaging
Transcript: ENSMUST00000019992
AA Change: H1498Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846
AA Change: H1498Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EGF_Lam 82 129 1.95e-8 SMART
EGF_Lam 132 184 5.78e-11 SMART
EGF_Lam 187 238 9.83e-14 SMART
Pfam:Laminin_I 283 548 5.3e-71 PFAM
coiled coil region 658 685 N/A INTRINSIC
LamG 850 1009 9.54e-11 SMART
LamG 1066 1205 5.9e-25 SMART
LamG 1250 1374 6.68e-24 SMART
LamG 1484 1619 1.54e-37 SMART
LamG 1661 1794 3.63e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Lama4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lama4 APN 10 39065595 splice site probably benign
IGL00091:Lama4 APN 10 39072805 missense probably damaging 1.00
IGL00429:Lama4 APN 10 39011026 missense possibly damaging 0.58
IGL00430:Lama4 APN 10 39045704 missense possibly damaging 0.54
IGL01074:Lama4 APN 10 39098488 critical splice donor site probably null
IGL01386:Lama4 APN 10 39011064 missense probably benign 0.00
IGL01603:Lama4 APN 10 39065646 missense possibly damaging 0.92
IGL01643:Lama4 APN 10 39056850 missense probably benign
IGL01655:Lama4 APN 10 39060213 missense probably benign
IGL01954:Lama4 APN 10 39087299 missense probably benign 0.05
IGL01984:Lama4 APN 10 39075529 critical splice donor site probably null
IGL02193:Lama4 APN 10 39042674 missense probably benign
IGL02290:Lama4 APN 10 39017364 missense probably benign 0.00
IGL02441:Lama4 APN 10 39061445 missense probably benign 0.20
IGL02549:Lama4 APN 10 39060204 missense probably benign 0.00
IGL02797:Lama4 APN 10 39056924 missense probably null 0.00
IGL02819:Lama4 APN 10 39026569 missense possibly damaging 0.80
IGL03122:Lama4 APN 10 39067963 missense probably benign
IGL03184:Lama4 APN 10 39078843 missense probably damaging 1.00
IGL03307:Lama4 APN 10 39017383 missense probably benign
BB006:Lama4 UTSW 10 39078847 missense probably damaging 1.00
BB016:Lama4 UTSW 10 39078847 missense probably damaging 1.00
PIT4585001:Lama4 UTSW 10 39074746 missense probably damaging 1.00
R0003:Lama4 UTSW 10 39060222 missense possibly damaging 0.55
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0035:Lama4 UTSW 10 39072738 missense probably benign 0.01
R0141:Lama4 UTSW 10 39092278 missense probably benign 0.05
R0257:Lama4 UTSW 10 39094884 splice site probably benign
R0267:Lama4 UTSW 10 39028639 missense probably damaging 0.96
R0557:Lama4 UTSW 10 39088397 missense probably benign 0.38
R1052:Lama4 UTSW 10 39092245 missense possibly damaging 0.68
R1248:Lama4 UTSW 10 39056847 missense probably damaging 0.99
R1249:Lama4 UTSW 10 39075478 missense probably damaging 1.00
R1291:Lama4 UTSW 10 39048069 missense probably benign 0.00
R1307:Lama4 UTSW 10 39070032 missense probably benign 0.06
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1443:Lama4 UTSW 10 39073643 missense probably damaging 1.00
R1499:Lama4 UTSW 10 39088880 missense possibly damaging 0.92
R1616:Lama4 UTSW 10 39075450 missense probably damaging 1.00
R1691:Lama4 UTSW 10 39080563 missense probably benign 0.09
R1748:Lama4 UTSW 10 39065619 missense probably benign 0.01
R1768:Lama4 UTSW 10 39103501 missense possibly damaging 0.82
R1772:Lama4 UTSW 10 39060224 missense probably benign 0.00
R1813:Lama4 UTSW 10 39033125 splice site probably benign
R1813:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1897:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1907:Lama4 UTSW 10 39072758 missense probably benign 0.13
R1943:Lama4 UTSW 10 39097138 missense possibly damaging 0.85
R2041:Lama4 UTSW 10 39069991 missense probably damaging 1.00
R2242:Lama4 UTSW 10 39026693 missense probably damaging 1.00
R2300:Lama4 UTSW 10 39087320 missense probably benign
R2326:Lama4 UTSW 10 39042567 splice site probably null
R2570:Lama4 UTSW 10 39075358 missense possibly damaging 0.94
R2570:Lama4 UTSW 10 39106047 missense probably damaging 1.00
R2571:Lama4 UTSW 10 39042675 missense possibly damaging 0.55
R2887:Lama4 UTSW 10 39092254 missense possibly damaging 0.94
R2926:Lama4 UTSW 10 39078832 missense probably benign 0.16
R3237:Lama4 UTSW 10 39097179 missense probably damaging 0.97
R4095:Lama4 UTSW 10 39097122 missense probably damaging 1.00
R4151:Lama4 UTSW 10 39005428 missense probably benign 0.00
R4470:Lama4 UTSW 10 39080496 nonsense probably null
R4812:Lama4 UTSW 10 39072769 missense probably benign
R4822:Lama4 UTSW 10 39033053 missense probably benign 0.01
R4997:Lama4 UTSW 10 39092266 missense probably damaging 0.99
R5119:Lama4 UTSW 10 39048054 missense probably benign 0.00
R5468:Lama4 UTSW 10 39072682 splice site probably null
R5909:Lama4 UTSW 10 39072859 missense probably benign 0.00
R5917:Lama4 UTSW 10 39048032 missense probably benign 0.10
R5927:Lama4 UTSW 10 39072812 missense probably damaging 1.00
R5950:Lama4 UTSW 10 39030448 missense probably benign 0.03
R6051:Lama4 UTSW 10 39067902 missense probably benign 0.01
R6277:Lama4 UTSW 10 39106010 missense probably damaging 1.00
R6294:Lama4 UTSW 10 39075470 missense probably damaging 1.00
R6372:Lama4 UTSW 10 39067952 missense probably benign
R6532:Lama4 UTSW 10 39048077 missense possibly damaging 0.58
R6547:Lama4 UTSW 10 39073656 missense probably damaging 1.00
R6578:Lama4 UTSW 10 39017365 missense probably benign 0.01
R6737:Lama4 UTSW 10 39094911 missense probably damaging 0.96
R6987:Lama4 UTSW 10 39074279 missense probably benign 0.00
R7040:Lama4 UTSW 10 39060162 missense possibly damaging 0.69
R7139:Lama4 UTSW 10 39075495 missense probably damaging 1.00
R7188:Lama4 UTSW 10 38965733 start gained probably benign
R7189:Lama4 UTSW 10 38965733 start gained probably benign
R7199:Lama4 UTSW 10 39080540 missense possibly damaging 0.84
R7211:Lama4 UTSW 10 39005495 missense probably damaging 0.98
R7274:Lama4 UTSW 10 39092299 missense probably benign 0.00
R7311:Lama4 UTSW 10 39026635 missense probably damaging 1.00
R7391:Lama4 UTSW 10 39087387 critical splice donor site probably null
R7399:Lama4 UTSW 10 39047948 missense probably damaging 0.98
R7426:Lama4 UTSW 10 39045755 missense possibly damaging 0.82
R7472:Lama4 UTSW 10 39087373 missense possibly damaging 0.65
R7635:Lama4 UTSW 10 39092188 missense probably benign
R7775:Lama4 UTSW 10 39078847 missense probably damaging 1.00
R7805:Lama4 UTSW 10 39026751 critical splice donor site probably null
R7885:Lama4 UTSW 10 39088844 missense probably benign 0.01
R7895:Lama4 UTSW 10 39088329 missense probably damaging 0.96
R7910:Lama4 UTSW 10 39070009 missense probably damaging 0.99
R7929:Lama4 UTSW 10 39078847 missense probably damaging 1.00
R7952:Lama4 UTSW 10 39030490 missense probably benign 0.39
R7991:Lama4 UTSW 10 39045809 missense possibly damaging 0.70
R8059:Lama4 UTSW 10 38966061 missense probably benign 0.00
R8194:Lama4 UTSW 10 39078720 missense probably damaging 0.99
R8248:Lama4 UTSW 10 39061379 missense possibly damaging 0.82
R8252:Lama4 UTSW 10 39060146 missense probably benign 0.00
R8265:Lama4 UTSW 10 39105204 missense probably damaging 1.00
R8275:Lama4 UTSW 10 39072811 missense probably damaging 1.00
R8426:Lama4 UTSW 10 39103491 missense probably damaging 0.98
R8434:Lama4 UTSW 10 39026707 missense possibly damaging 0.92
X0067:Lama4 UTSW 10 39045692 missense probably benign 0.00
Z1177:Lama4 UTSW 10 39005424 nonsense probably null
Z1177:Lama4 UTSW 10 39005425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAGTAACCATGCCTACG -3'
(R):5'- GCTGACAGCACTATTCTCTGC -3'

Sequencing Primer
(F):5'- CTAATTAAGGCATCACTGGGGAC -3'
(R):5'- GACAGCACTATTCTCTGCATTCAAC -3'
Posted On2019-06-26