Incidental Mutation 'R0582:9230019H11Rik'
ID56471
Institutional Source Beutler Lab
Gene Symbol 9230019H11Rik
Ensembl Gene ENSMUSG00000071434
Gene NameRIKEN cDNA 9230019H11 gene
Synonyms
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R0582 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location3119841-3129546 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 3125082 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095874
SMART Domains Protein: ENSMUSP00000093559
Gene: ENSMUSG00000071434

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PDB:1KCG|C 57 207 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217333
Meta Mutation Damage Score 0.3193 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in 9230019H11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:9230019H11Rik APN 10 3120231 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3120209 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3125031 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3125193 exon noncoding transcript
IGL02388:9230019H11Rik APN 10 3125050 unclassified noncoding transcript
IGL02560:9230019H11Rik APN 10 3125866 exon noncoding transcript
IGL03293:9230019H11Rik APN 10 3125699 exon noncoding transcript
R0357:9230019H11Rik UTSW 10 3120307 unclassified noncoding transcript
R0357:9230019H11Rik UTSW 10 3125788 exon noncoding transcript
R0680:9230019H11Rik UTSW 10 3125133 exon noncoding transcript
R1116:9230019H11Rik UTSW 10 3120180 unclassified noncoding transcript
R1519:9230019H11Rik UTSW 10 3125230 exon noncoding transcript
R1717:9230019H11Rik UTSW 10 3125050 unclassified noncoding transcript
R2112:9230019H11Rik UTSW 10 3126459 exon noncoding transcript
R5410:9230019H11Rik UTSW 10 3126473 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACTTTTCCTGCCATGACAGACAGTG -3'
(R):5'- CCCGCATTTGAAGTAGCACATCTTG -3'

Sequencing Primer
(F):5'- TTACTTAGCACAGTGAAGATGGGTC -3'
(R):5'- TTGAAGTAGCACATCTTGGAAGTG -3'
Posted On2013-07-11