Incidental Mutation 'R7262:Acap2'
ID564710
Institutional Source Beutler Lab
Gene Symbol Acap2
Ensembl Gene ENSMUSG00000049076
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 2
SynonymsCentb2, 9530039J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location31092412-31201245 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 31127319 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058033] [ENSMUST00000229010] [ENSMUST00000230614] [ENSMUST00000230698] [ENSMUST00000231125]
Predicted Effect probably null
Transcript: ENSMUST00000058033
SMART Domains Protein: ENSMUSP00000061501
Gene: ENSMUSG00000049076

DomainStartEndE-ValueType
Pfam:BAR_3 5 238 9.1e-96 PFAM
PH 267 363 1.73e-17 SMART
ArfGap 399 520 2.23e-63 SMART
ANK 632 661 6.71e-2 SMART
ANK 665 694 3.04e0 SMART
ANK 698 727 6.64e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000229010
Predicted Effect probably null
Transcript: ENSMUST00000230614
Predicted Effect probably benign
Transcript: ENSMUST00000230698
Predicted Effect probably null
Transcript: ENSMUST00000231125
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Acap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Acap2 APN 16 31139475 missense probably damaging 1.00
IGL01330:Acap2 APN 16 31154677 missense probably damaging 1.00
IGL01420:Acap2 APN 16 31101819 splice site probably benign
IGL02064:Acap2 APN 16 31127328 missense probably damaging 1.00
IGL02173:Acap2 APN 16 31108147 missense possibly damaging 0.68
IGL02453:Acap2 APN 16 31131257 splice site probably null
IGL02883:Acap2 APN 16 31096345 unclassified probably benign
IGL03203:Acap2 APN 16 31096345 unclassified probably benign
IGL03342:Acap2 APN 16 31105492 missense probably damaging 1.00
R1251:Acap2 UTSW 16 31108171 missense probably damaging 1.00
R1377:Acap2 UTSW 16 31116051 missense probably damaging 1.00
R1432:Acap2 UTSW 16 31111083 missense probably damaging 1.00
R1546:Acap2 UTSW 16 31104936 nonsense probably null
R1594:Acap2 UTSW 16 31127387 missense probably benign 0.01
R1829:Acap2 UTSW 16 31110934 missense probably damaging 1.00
R1853:Acap2 UTSW 16 31117304 missense probably damaging 1.00
R1970:Acap2 UTSW 16 31133527 critical splice donor site probably null
R2023:Acap2 UTSW 16 31119415 missense probably damaging 0.99
R2086:Acap2 UTSW 16 31110945 missense probably damaging 1.00
R2145:Acap2 UTSW 16 31105524 missense probably benign
R2177:Acap2 UTSW 16 31133528 critical splice donor site probably null
R2214:Acap2 UTSW 16 31108128 missense probably benign 0.19
R2392:Acap2 UTSW 16 31139640 missense probably damaging 0.99
R2438:Acap2 UTSW 16 31117315 missense probably damaging 1.00
R2913:Acap2 UTSW 16 31116069 missense probably damaging 0.99
R4207:Acap2 UTSW 16 31119427 missense probably damaging 0.99
R4274:Acap2 UTSW 16 31108114 missense probably benign 0.01
R4814:Acap2 UTSW 16 31108126 missense probably benign
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R4860:Acap2 UTSW 16 31103499 missense possibly damaging 0.92
R5310:Acap2 UTSW 16 31133609 missense probably benign 0.00
R5345:Acap2 UTSW 16 31108126 missense probably benign
R5388:Acap2 UTSW 16 31109725 missense probably damaging 1.00
R5551:Acap2 UTSW 16 31104908 missense probably damaging 1.00
R5578:Acap2 UTSW 16 31108114 missense probably benign 0.00
R6341:Acap2 UTSW 16 31105546 missense possibly damaging 0.86
R6659:Acap2 UTSW 16 31131315 missense probably damaging 0.99
R6977:Acap2 UTSW 16 31117261 missense probably damaging 1.00
R7304:Acap2 UTSW 16 31108116 missense probably benign 0.05
R7310:Acap2 UTSW 16 31108154 nonsense probably null
R7318:Acap2 UTSW 16 31127337 missense probably damaging 1.00
R7514:Acap2 UTSW 16 31154567 splice site probably null
R7875:Acap2 UTSW 16 31139641 missense probably damaging 0.99
R8256:Acap2 UTSW 16 31139469 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTCCAGTCATTACAGCCC -3'
(R):5'- GACTCCAAACTTTTCTCTAAAGCCC -3'

Sequencing Primer
(F):5'- AGCATTCTAAGAACTAGCTCTCTC -3'
(R):5'- AAAGCCCTTTTCCCTGGATAAATTTC -3'
Posted On2019-06-26