Incidental Mutation 'R7262:Tmem232'
ID564715
Institutional Source Beutler Lab
Gene Symbol Tmem232
Ensembl Gene ENSMUSG00000045036
Gene Nametransmembrane protein 232
SynonymsLOC381107, E130009J12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location65256005-65540782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65500117 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 27 (I27N)
Ref Sequence ENSEMBL: ENSMUSP00000055652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062161] [ENSMUST00000086722]
Predicted Effect probably benign
Transcript: ENSMUST00000062161
AA Change: I27N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055652
Gene: ENSMUSG00000045036
AA Change: I27N

DomainStartEndE-ValueType
Pfam:TMEM232 40 488 5.3e-235 PFAM
coiled coil region 598 634 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086722
AA Change: I27N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083927
Gene: ENSMUSG00000045036
AA Change: I27N

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
coiled coil region 598 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pam T C 1: 97,854,723 K157R Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Tmem232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Tmem232 APN 17 65256574 missense possibly damaging 0.71
IGL00954:Tmem232 APN 17 65500153 missense probably damaging 1.00
IGL01530:Tmem232 APN 17 65256548 nonsense probably null
IGL02881:Tmem232 APN 17 65450370 missense probably damaging 1.00
IGL02969:Tmem232 APN 17 65256563 missense possibly damaging 0.69
IGL02972:Tmem232 APN 17 65476673 missense probably benign 0.00
IGL03028:Tmem232 APN 17 65256389 missense probably benign 0.14
IGL03293:Tmem232 APN 17 65450374 missense probably damaging 1.00
R0380:Tmem232 UTSW 17 65256448 missense probably benign 0.23
R0432:Tmem232 UTSW 17 65256503 missense probably damaging 0.99
R0524:Tmem232 UTSW 17 65485942 missense probably damaging 0.98
R0548:Tmem232 UTSW 17 65382620 missense probably benign 0.22
R1345:Tmem232 UTSW 17 65450406 missense possibly damaging 0.60
R1521:Tmem232 UTSW 17 65484501 missense probably damaging 0.99
R1954:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R1955:Tmem232 UTSW 17 65484487 missense probably benign 0.01
R2012:Tmem232 UTSW 17 65500172 missense probably benign 0.21
R2294:Tmem232 UTSW 17 65450441 missense probably benign 0.00
R2369:Tmem232 UTSW 17 65402997 missense probably damaging 1.00
R2384:Tmem232 UTSW 17 65402857 missense probably damaging 1.00
R2894:Tmem232 UTSW 17 65450413 missense probably damaging 1.00
R3431:Tmem232 UTSW 17 65265302 splice site probably null
R3788:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R3789:Tmem232 UTSW 17 65382525 missense probably benign 0.02
R3789:Tmem232 UTSW 17 65382633 missense possibly damaging 0.71
R4155:Tmem232 UTSW 17 65436333 missense probably damaging 0.97
R4691:Tmem232 UTSW 17 65265242 missense possibly damaging 0.88
R4838:Tmem232 UTSW 17 65430888 missense probably benign 0.04
R5340:Tmem232 UTSW 17 65402998 missense possibly damaging 0.92
R5619:Tmem232 UTSW 17 65486511 missense probably benign 0.06
R6176:Tmem232 UTSW 17 65485872 missense probably damaging 1.00
R6192:Tmem232 UTSW 17 65430805 missense probably damaging 1.00
R6223:Tmem232 UTSW 17 65500196 start codon destroyed probably null 0.99
R6256:Tmem232 UTSW 17 65478402 missense possibly damaging 0.89
R6782:Tmem232 UTSW 17 65500124 missense possibly damaging 0.88
R6856:Tmem232 UTSW 17 65450310 missense possibly damaging 0.57
R7459:Tmem232 UTSW 17 65256389 missense probably benign 0.14
R7699:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R7700:Tmem232 UTSW 17 65265218 missense probably damaging 0.97
R8284:Tmem232 UTSW 17 65402995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCATTTCTTGAATCCAGTTGC -3'
(R):5'- AGCCTGATTTTCTTCTTGGTACAG -3'

Sequencing Primer
(F):5'- CATAACTCTTTGCaataaatgataa -3'
(R):5'- ACAGTTTATAGGTTTTGCATGTGG -3'
Posted On2019-06-26