Incidental Mutation 'R0582:Arfgef3'
ID56472
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene NameARFGEF family member 3
SynonymsB930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0582 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18581839-18743949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18611290 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1332 (A1332V)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
Predicted Effect probably benign
Transcript: ENSMUST00000019999
AA Change: A1332V

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: A1332V

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: A1332V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2935 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R7934:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACCTCCCTACAAAACAATTTTGG -3'
(R):5'- AAGCAGCAAGACGTGGTATCTATTCAG -3'

Sequencing Primer
(F):5'- CAATTTTGGGAAGGGTCTACAATGAC -3'
(R):5'- tcccccataccctcccc -3'
Posted On2013-07-11