Incidental Mutation 'R7263:Sctr'
ID564723
Institutional Source Beutler Lab
Gene Symbol Sctr
Ensembl Gene ENSMUSG00000026387
Gene Namesecretin receptor
Synonyms6530402O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location120006894-120063536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120022225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 48 (R48Q)
Ref Sequence ENSEMBL: ENSMUSP00000139932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072886] [ENSMUST00000189037]
Predicted Effect probably benign
Transcript: ENSMUST00000072886
AA Change: R48Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072660
Gene: ENSMUSG00000026387
AA Change: R48Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 76 146 5.18e-21 SMART
Pfam:7tm_2 153 398 3.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189037
AA Change: R48Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139932
Gene: ENSMUSG00000026387
AA Change: R48Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 61 131 2.59e-21 SMART
Pfam:7tm_2 138 383 1.9e-89 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and belongs to the glucagon-VIP-secretin receptor family. It binds secretin which is the most potent regulator of pancreatic bicarbonate, electrolyte and volume secretion. Secretin and its receptor are suggested to be involved in pancreatic cancer and autism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show polydipsia, polyuria, decreased urine osmolality, higher serum glucose levels, kidney glomerular and tubular pathology, and impaired renal water reabsorption. Homozygotes for a different null allele show impaired synaptic plasticity and social behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Sctr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Sctr APN 1 120044720 missense probably damaging 1.00
IGL01542:Sctr APN 1 120044769 splice site probably benign
IGL02798:Sctr APN 1 120022180 missense probably damaging 1.00
IGL02850:Sctr APN 1 120044663 missense possibly damaging 0.95
IGL02850:Sctr APN 1 120022179 missense probably damaging 1.00
IGL03256:Sctr APN 1 120031559 splice site probably benign
PIT4677001:Sctr UTSW 1 120061904 missense probably damaging 1.00
R0018:Sctr UTSW 1 120043556 splice site probably benign
R0166:Sctr UTSW 1 120055394 missense probably damaging 0.97
R1678:Sctr UTSW 1 120036439 critical splice donor site probably null
R1728:Sctr UTSW 1 120031656 missense probably benign 0.00
R1728:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1729:Sctr UTSW 1 120031656 missense probably benign 0.00
R1729:Sctr UTSW 1 120063246 missense probably benign 0.16
R1729:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1730:Sctr UTSW 1 120031656 missense probably benign 0.00
R1730:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1739:Sctr UTSW 1 120031656 missense probably benign 0.00
R1739:Sctr UTSW 1 120063246 missense probably benign 0.16
R1739:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1762:Sctr UTSW 1 120031656 missense probably benign 0.00
R1762:Sctr UTSW 1 120063246 missense probably benign 0.16
R1762:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1783:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120063246 missense probably benign 0.16
R1785:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R2116:Sctr UTSW 1 120031582 missense probably damaging 1.00
R5522:Sctr UTSW 1 120036416 missense probably benign 0.10
R5776:Sctr UTSW 1 120056407 missense probably damaging 1.00
R5781:Sctr UTSW 1 120031620 missense probably damaging 0.99
R6333:Sctr UTSW 1 120056452 missense probably damaging 1.00
R7084:Sctr UTSW 1 120063271 missense possibly damaging 0.77
R7265:Sctr UTSW 1 120022225 missense probably benign
R7266:Sctr UTSW 1 120022225 missense probably benign
R7304:Sctr UTSW 1 120022240 missense probably damaging 1.00
R7343:Sctr UTSW 1 120022225 missense probably benign
R8063:Sctr UTSW 1 120063275 missense probably benign 0.09
X0067:Sctr UTSW 1 120007299 missense probably benign
Z1088:Sctr UTSW 1 120036406 frame shift probably null
Z1176:Sctr UTSW 1 120022249 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCGAGTTGGTATTCCCAC -3'
(R):5'- TGAAGATGCTGCCTTCTGAG -3'

Sequencing Primer
(F):5'- GAGTTGGTATTCCCACCCTCTG -3'
(R):5'- ATCCGACAGCTGATTGAGTGTAC -3'
Posted On2019-06-26