Mutagenetix > Incidental Mutation

Incidental Mutation 'R7263:Pik3c2b'

564724

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R7263 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 133090202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 934 (P934L)

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably damaging
Transcript: ENSMUST00000077730
AA Change: P934L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: P934L

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	A	3: 122,054,194	H55N	probably damaging	Het
Acan	G	T	7: 79,092,318	V488L	probably damaging	Het
Adam12	T	C	7: 133,919,511	E638G	possibly damaging	Het
Adamts20	T	A	15: 94,322,891	Q1387L	possibly damaging	Het
Adamts3	G	T	5: 89,677,742	D1079E	probably benign	Het
Barx1	G	T	13: 48,665,079	G93C	probably damaging	Het
Carmil2	C	T	8: 105,693,045	R828C	probably damaging	Het
Catsper4	TTCTC	TTC	4: 134,227,112		probably null	Het
Ccdc159	T	C	9: 21,931,711	M148T	probably benign	Het
Cdk5rap1	T	A	2: 154,360,732	N193Y	probably benign	Het
Csnk1g2	G	A	10: 80,634,498	G15D	probably damaging	Het
Dach1	T	C	14: 98,168,859	S151G	probably benign	Het
Elf5	C	A	2: 103,439,300	N75K	probably benign	Het
Elp3	T	C	14: 65,565,333	D272G	probably damaging	Het
Epb41l1	T	A	2: 156,495,123		probably null	Het
Epha6	A	G	16: 59,775,665	Y888H	probably damaging	Het
Fibcd1	T	C	2: 31,817,210	Y345C	probably damaging	Het
Gjc1	C	T	11: 102,800,137	E347K	possibly damaging	Het
Gm16486	A	G	8: 70,710,776	N873D	possibly damaging	Het
Gse1	A	G	8: 120,574,171	D892G	unknown	Het
Gtpbp6	A	T	5: 110,104,049	I506N	probably benign	Het
Hivep1	T	A	13: 42,158,192	F1303I	possibly damaging	Het
Il21r	A	G	7: 125,632,905	T502A	probably benign	Het
Ints1	T	C	5: 139,764,079	T997A	possibly damaging	Het
Invs	C	A	4: 48,396,381	N351K	probably damaging	Het
Iqcm	A	G	8: 75,763,073	T390A	probably benign	Het
Kcnh4	C	T	11: 100,741,817	G948D	probably benign	Het
Kcnh7	T	A	2: 62,735,970		probably null	Het
Lrrc72	A	G	12: 36,208,612	V82A	probably damaging	Het
Macf1	A	T	4: 123,378,150	L6535Q	probably damaging	Het
Ncor2	G	C	5: 125,032,132	L585V		Het
Nipal2	G	C	15: 34,578,758	Y298*	probably null	Het
Nipsnap1	C	T	11: 4,882,960		probably benign	Het
Olfr1112	T	A	2: 87,192,132	C148*	probably null	Het
Olfr1267-ps1	T	C	2: 90,085,988	I158V	not run	Het
Olfr578	A	T	7: 102,984,317	Y282*	probably null	Het
Pcdhga4	C	T	18: 37,686,820	T474I	probably benign	Het
Pdp1	G	T	4: 11,960,821	Q516K	possibly damaging	Het
Pp2d1	A	G	17: 53,515,330	I236T	probably benign	Het
Pygm	G	A	19: 6,388,327	R278H	probably damaging	Het
Rb1	A	T	14: 73,282,923	C215*	probably null	Het
Rgs22	A	G	15: 36,015,643	S1156P	possibly damaging	Het
Rgs9bp	T	C	7: 35,584,701	T174A	probably damaging	Het
Rnf133	A	T	6: 23,649,668	Y130*	probably null	Het
Sctr	G	A	1: 120,022,225	R48Q	probably benign	Het
Serpinb6e	A	T	13: 33,838,940	F153L	probably benign	Het
Slc22a1	A	T	17: 12,666,700	Y200N	probably damaging	Het
Slc22a22	C	A	15: 57,249,711	M377I	probably benign	Het
Slc36a4	A	G	9: 15,722,156		probably null	Het
Slc39a6	A	G	18: 24,601,203	V143A	probably benign	Het
Slf2	G	A	19: 44,938,424		probably null	Het
Sowaha	T	C	11: 53,479,658	K84E	probably benign	Het
Spef2	T	G	15: 9,653,012		probably null	Het
Sphkap	A	T	1: 83,276,678	F1117I	probably damaging	Het
Tas2r113	T	C	6: 132,893,576	I189T	possibly damaging	Het
Tescl	T	C	7: 24,333,822	E26G	possibly damaging	Het
Trpm6	A	T	19: 18,876,786	I1847F	probably damaging	Het
Uba1y	T	A	Y: 822,200	C178S	possibly damaging	Het
Ush2a	T	A	1: 188,443,329	V1208D	possibly damaging	Het
Usp13	G	C	3: 32,894,851	A446P	probably damaging	Het
Usp7	A	T	16: 8,696,724	C722S	possibly damaging	Het
Vmn1r52	A	G	6: 90,179,553	S280G	probably benign	Het
Vmn2r84	T	C	10: 130,389,208	K478E	probably damaging	Het
Zfp112	C	A	7: 24,125,527	L311I	probably benign	Het
Zfp180	G	T	7: 24,105,700	E515*	probably null	Het
Zfp518b	A	G	5: 38,672,328	I778T	probably damaging	Het
Zfp800	A	T	6: 28,243,663	H434Q	probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAAGGCTCTAACCTCTTTTGCAG -3'
(R):5'- CAACATCCTGGAGCCTGATCTC -3'

Sequencing Primer
(F):5'- GATCGGCTCCCTCTCAGATG -3'
(R):5'- TGGAGCCTGATCTCGTAGCTC -3'

Posted On

2019-06-26