Incidental Mutation 'R7263:Pdp1'
ID564734
Institutional Source Beutler Lab
Gene Symbol Pdp1
Ensembl Gene ENSMUSG00000049225
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 1
SynonymsLOC381511, Ppm2c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11958184-11966452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11960821 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 516 (Q516K)
Ref Sequence ENSEMBL: ENSMUSP00000103936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056050] [ENSMUST00000095144] [ENSMUST00000108297] [ENSMUST00000108299] [ENSMUST00000108301] [ENSMUST00000108302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056050
AA Change: Q457K

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050521
Gene: ENSMUSG00000049225
AA Change: Q457K

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095144
AA Change: Q482K

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092766
Gene: ENSMUSG00000049225
AA Change: Q482K

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108297
AA Change: Q457K

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103932
Gene: ENSMUSG00000049225
AA Change: Q457K

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108299
AA Change: Q482K

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103934
Gene: ENSMUSG00000049225
AA Change: Q482K

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108301
AA Change: Q516K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103936
Gene: ENSMUSG00000049225
AA Change: Q516K

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
PP2Cc 158 582 3.36e-97 SMART
PP2C_SIG 236 584 2.77e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108302
AA Change: Q497K

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103937
Gene: ENSMUSG00000049225
AA Change: Q497K

DomainStartEndE-ValueType
PP2Cc 139 563 3.36e-97 SMART
PP2C_SIG 217 565 2.77e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (E1) is one of the three components (E1, E2, and E3) of the large pyruvate dehydrogenase complex. Pyruvate dehydrogenase kinases catalyze phosphorylation of serine residues of E1 to inactivate the E1 component and inhibit the complex. Pyruvate dehydrogenase phosphatases catalyze the dephosphorylation and activation of the E1 component to reverse the effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase phosphatase is a heterodimer consisting of catalytic and regulatory subunits. Two catalytic subunits have been reported; one is predominantly expressed in skeletal muscle and another one is is much more abundant in the liver. The catalytic subunit, encoded by this gene, is the former, and belongs to the protein phosphatase 2C (PP2C) superfamily. Along with the pyruvate dehydrogenase complex and pyruvate dehydrogenase kinases, this enzyme is located in the mitochondrial matrix. Mutation in this gene causes pyruvate dehydrogenase phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Pdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02243:Pdp1 APN 4 11961873 missense probably benign 0.20
IGL02643:Pdp1 APN 4 11962062 missense probably benign
R1931:Pdp1 UTSW 4 11962074 missense probably benign 0.01
R2162:Pdp1 UTSW 4 11961123 missense probably damaging 0.98
R2418:Pdp1 UTSW 4 11961838 missense probably damaging 0.98
R3843:Pdp1 UTSW 4 11961961 missense probably benign 0.00
R5699:Pdp1 UTSW 4 11960907 missense possibly damaging 0.79
R6479:Pdp1 UTSW 4 11961327 missense probably damaging 1.00
R7221:Pdp1 UTSW 4 11961004 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTATGCCCCTACAACATGAG -3'
(R):5'- ACTGCTGAGCCAGAGGTAAC -3'

Sequencing Primer
(F):5'- GGTATGCCCCTACAACATGAGAATTG -3'
(R):5'- GGTAACTTATCACAGATTAAGGCCAC -3'
Posted On2019-06-26