Mutagenetix > Incidental Mutation

Incidental Mutation 'R7263:Invs'

564735

Institutional Source

Beutler Lab

Gene Symbol

Invs

Ensembl Gene

ENSMUSG00000028344

Gene Name

inversin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R7263 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48279760-48431954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 48396381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 351 (N351K)

Ref Sequence

ENSEMBL: ENSMUSP00000030029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030029
AA Change: N351K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: N351K

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	148	177	6.46e-4	SMART
ANK	181	215	3.44e1	SMART
ANK	220	250	1.11e-2	SMART
ANK	254	285	2.07e-2	SMART
ANK	288	317	3.18e-3	SMART
ANK	321	350	3.91e-3	SMART
ANK	356	385	2.28e-4	SMART
ANK	389	418	8.39e-3	SMART
ANK	422	451	3.76e-5	SMART
ANK	455	484	2.45e-4	SMART
ANK	488	517	1.31e-4	SMART
ANK	523	553	6.71e-2	SMART
IQ	554	576	5.75e-2	SMART
low complexity region	589	607	N/A	INTRINSIC
IQ	913	935	2.46e-1	SMART
low complexity region	973	989	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000143433
AA Change: N295K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: N295K

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	164	194	1.11e-2	SMART
ANK	198	229	2.07e-2	SMART
ANK	232	261	3.18e-3	SMART
ANK	265	294	3.91e-3	SMART
ANK	300	329	2.28e-4	SMART
ANK	333	362	8.39e-3	SMART
ANK	366	395	3.76e-5	SMART
ANK	399	428	2.45e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	A	3: 122,054,194	H55N	probably damaging	Het
Acan	G	T	7: 79,092,318	V488L	probably damaging	Het
Adam12	T	C	7: 133,919,511	E638G	possibly damaging	Het
Adamts20	T	A	15: 94,322,891	Q1387L	possibly damaging	Het
Adamts3	G	T	5: 89,677,742	D1079E	probably benign	Het
Barx1	G	T	13: 48,665,079	G93C	probably damaging	Het
Carmil2	C	T	8: 105,693,045	R828C	probably damaging	Het
Catsper4	TTCTC	TTC	4: 134,227,112		probably null	Het
Ccdc159	T	C	9: 21,931,711	M148T	probably benign	Het
Cdk5rap1	T	A	2: 154,360,732	N193Y	probably benign	Het
Csnk1g2	G	A	10: 80,634,498	G15D	probably damaging	Het
Dach1	T	C	14: 98,168,859	S151G	probably benign	Het
Elf5	C	A	2: 103,439,300	N75K	probably benign	Het
Elp3	T	C	14: 65,565,333	D272G	probably damaging	Het
Epb41l1	T	A	2: 156,495,123		probably null	Het
Epha6	A	G	16: 59,775,665	Y888H	probably damaging	Het
Fibcd1	T	C	2: 31,817,210	Y345C	probably damaging	Het
Gjc1	C	T	11: 102,800,137	E347K	possibly damaging	Het
Gm16486	A	G	8: 70,710,776	N873D	possibly damaging	Het
Gse1	A	G	8: 120,574,171	D892G	unknown	Het
Gtpbp6	A	T	5: 110,104,049	I506N	probably benign	Het
Hivep1	T	A	13: 42,158,192	F1303I	possibly damaging	Het
Il21r	A	G	7: 125,632,905	T502A	probably benign	Het
Ints1	T	C	5: 139,764,079	T997A	possibly damaging	Het
Iqcm	A	G	8: 75,763,073	T390A	probably benign	Het
Kcnh4	C	T	11: 100,741,817	G948D	probably benign	Het
Kcnh7	T	A	2: 62,735,970		probably null	Het
Lrrc72	A	G	12: 36,208,612	V82A	probably damaging	Het
Macf1	A	T	4: 123,378,150	L6535Q	probably damaging	Het
Ncor2	G	C	5: 125,032,132	L585V		Het
Nipal2	G	C	15: 34,578,758	Y298*	probably null	Het
Nipsnap1	C	T	11: 4,882,960		probably benign	Het
Olfr1112	T	A	2: 87,192,132	C148*	probably null	Het
Olfr1267-ps1	T	C	2: 90,085,988	I158V	not run	Het
Olfr578	A	T	7: 102,984,317	Y282*	probably null	Het
Pcdhga4	C	T	18: 37,686,820	T474I	probably benign	Het
Pdp1	G	T	4: 11,960,821	Q516K	possibly damaging	Het
Pik3c2b	C	T	1: 133,090,202	P934L	probably damaging	Het
Pp2d1	A	G	17: 53,515,330	I236T	probably benign	Het
Pygm	G	A	19: 6,388,327	R278H	probably damaging	Het
Rb1	A	T	14: 73,282,923	C215*	probably null	Het
Rgs22	A	G	15: 36,015,643	S1156P	possibly damaging	Het
Rgs9bp	T	C	7: 35,584,701	T174A	probably damaging	Het
Rnf133	A	T	6: 23,649,668	Y130*	probably null	Het
Sctr	G	A	1: 120,022,225	R48Q	probably benign	Het
Serpinb6e	A	T	13: 33,838,940	F153L	probably benign	Het
Slc22a1	A	T	17: 12,666,700	Y200N	probably damaging	Het
Slc22a22	C	A	15: 57,249,711	M377I	probably benign	Het
Slc36a4	A	G	9: 15,722,156		probably null	Het
Slc39a6	A	G	18: 24,601,203	V143A	probably benign	Het
Slf2	G	A	19: 44,938,424		probably null	Het
Sowaha	T	C	11: 53,479,658	K84E	probably benign	Het
Spef2	T	G	15: 9,653,012		probably null	Het
Sphkap	A	T	1: 83,276,678	F1117I	probably damaging	Het
Tas2r113	T	C	6: 132,893,576	I189T	possibly damaging	Het
Tescl	T	C	7: 24,333,822	E26G	possibly damaging	Het
Trpm6	A	T	19: 18,876,786	I1847F	probably damaging	Het
Uba1y	T	A	Y: 822,200	C178S	possibly damaging	Het
Ush2a	T	A	1: 188,443,329	V1208D	possibly damaging	Het
Usp13	G	C	3: 32,894,851	A446P	probably damaging	Het
Usp7	A	T	16: 8,696,724	C722S	possibly damaging	Het
Vmn1r52	A	G	6: 90,179,553	S280G	probably benign	Het
Vmn2r84	T	C	10: 130,389,208	K478E	probably damaging	Het
Zfp112	C	A	7: 24,125,527	L311I	probably benign	Het
Zfp180	G	T	7: 24,105,700	E515*	probably null	Het
Zfp518b	A	G	5: 38,672,328	I778T	probably damaging	Het
Zfp800	A	T	6: 28,243,663	H434Q	probably benign	Het

Other mutations in Invs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Invs	APN	4	48402909	missense	probably damaging	0.98
IGL00487:Invs	APN	4	48407689	nonsense	probably null
IGL01487:Invs	APN	4	48398136	missense	probably benign	0.26
IGL01696:Invs	APN	4	48425997	missense	probably damaging	1.00
IGL02238:Invs	APN	4	48390029	missense	probably damaging	1.00
IGL03286:Invs	APN	4	48382261	missense	probably benign	0.26
R0645:Invs	UTSW	4	48407653	missense	probably benign	0.00
R0661:Invs	UTSW	4	48421861	missense	probably benign
R0698:Invs	UTSW	4	48396364	missense	probably benign	0.04
R0763:Invs	UTSW	4	48392628	missense	possibly damaging	0.82
R1183:Invs	UTSW	4	48421725	missense	possibly damaging	0.68
R1381:Invs	UTSW	4	48421942	nonsense	probably null
R1511:Invs	UTSW	4	48382148	missense	possibly damaging	0.82
R1843:Invs	UTSW	4	48422035	missense	probably damaging	0.96
R1903:Invs	UTSW	4	48402824	splice site	probably null
R1928:Invs	UTSW	4	48390095	missense	probably damaging	1.00
R1990:Invs	UTSW	4	48392599	missense	possibly damaging	0.88
R2063:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2064:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2065:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2066:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R4744:Invs	UTSW	4	48397609	missense	probably damaging	1.00
R4997:Invs	UTSW	4	48396332	missense	probably damaging	0.98
R5011:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5013:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5083:Invs	UTSW	4	48396307	missense	possibly damaging	0.90
R5184:Invs	UTSW	4	48283242	utr 5 prime	probably benign
R5258:Invs	UTSW	4	48396374	missense	possibly damaging	0.82
R5375:Invs	UTSW	4	48385262	missense	probably benign	0.12
R5509:Invs	UTSW	4	48396337	missense	probably damaging	1.00
R5560:Invs	UTSW	4	48416084	missense	probably benign	0.00
R5748:Invs	UTSW	4	48307823	missense	probably damaging	0.98
R5813:Invs	UTSW	4	48398146	missense	probably damaging	0.98
R5840:Invs	UTSW	4	48396284	missense	probably damaging	1.00
R5984:Invs	UTSW	4	48421674	missense	probably benign	0.00
R6513:Invs	UTSW	4	48397534	missense	possibly damaging	0.46
R6637:Invs	UTSW	4	48416203	splice site	probably null
R6667:Invs	UTSW	4	48402870	missense	possibly damaging	0.66
R6838:Invs	UTSW	4	48283278	missense	possibly damaging	0.95
R6921:Invs	UTSW	4	48396260	missense	possibly damaging	0.46
R6945:Invs	UTSW	4	48421785	missense	probably benign	0.00
R7102:Invs	UTSW	4	48407674	missense	probably benign	0.21
R7142:Invs	UTSW	4	48407696	missense	probably damaging	1.00
R7283:Invs	UTSW	4	48392526	splice site	probably null
R7461:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7503:Invs	UTSW	4	48396347	missense	probably damaging	0.96
R7581:Invs	UTSW	4	48421909	missense	probably benign	0.00
R7613:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7861:Invs	UTSW	4	48397559	missense	possibly damaging	0.50
R8316:Invs	UTSW	4	48426199	missense	possibly damaging	0.68
R8321:Invs	UTSW	4	48283267	missense	probably benign	0.13
R8500:Invs	UTSW	4	48422109	missense	probably damaging	1.00
R8544:Invs	UTSW	4	48397598	missense	probably damaging	0.96
R9171:Invs	UTSW	4	48398149	missense	possibly damaging	0.90
R9663:Invs	UTSW	4	48426218	missense	probably damaging	1.00
X0026:Invs	UTSW	4	48398221	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCACACAGGTGCTCTATTACC -3'
(R):5'- TTTGGAGTAAGATCTTGGCAAACTC -3'

Sequencing Primer
(F):5'- GTAGAGATGTTCTCCACCACTGCAG -3'
(R):5'- GTAAGATCTTGGCAAACTCAAGATC -3'

Posted On

2019-06-26