Mutagenetix > Incidental Mutation

Incidental Mutation 'R7263:Adamts3'

564739

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7263 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 89677742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1079 (D1079E)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

probably benign
Transcript: ENSMUST00000061427
AA Change: D1078E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: D1078E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159
AA Change: D1079E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: D1079E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Meta Mutation Damage Score

0.0915

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	C	A	3: 122,054,194	H55N	probably damaging	Het
Acan	G	T	7: 79,092,318	V488L	probably damaging	Het
Adam12	T	C	7: 133,919,511	E638G	possibly damaging	Het
Adamts20	T	A	15: 94,322,891	Q1387L	possibly damaging	Het
Barx1	G	T	13: 48,665,079	G93C	probably damaging	Het
Carmil2	C	T	8: 105,693,045	R828C	probably damaging	Het
Catsper4	TTCTC	TTC	4: 134,227,112		probably null	Het
Ccdc159	T	C	9: 21,931,711	M148T	probably benign	Het
Cdk5rap1	T	A	2: 154,360,732	N193Y	probably benign	Het
Csnk1g2	G	A	10: 80,634,498	G15D	probably damaging	Het
Dach1	T	C	14: 98,168,859	S151G	probably benign	Het
Elf5	C	A	2: 103,439,300	N75K	probably benign	Het
Elp3	T	C	14: 65,565,333	D272G	probably damaging	Het
Epb41l1	T	A	2: 156,495,123		probably null	Het
Epha6	A	G	16: 59,775,665	Y888H	probably damaging	Het
Fibcd1	T	C	2: 31,817,210	Y345C	probably damaging	Het
Gjc1	C	T	11: 102,800,137	E347K	possibly damaging	Het
Gm16486	A	G	8: 70,710,776	N873D	possibly damaging	Het
Gse1	A	G	8: 120,574,171	D892G	unknown	Het
Gtpbp6	A	T	5: 110,104,049	I506N	probably benign	Het
Hivep1	T	A	13: 42,158,192	F1303I	possibly damaging	Het
Il21r	A	G	7: 125,632,905	T502A	probably benign	Het
Ints1	T	C	5: 139,764,079	T997A	possibly damaging	Het
Invs	C	A	4: 48,396,381	N351K	probably damaging	Het
Iqcm	A	G	8: 75,763,073	T390A	probably benign	Het
Kcnh4	C	T	11: 100,741,817	G948D	probably benign	Het
Kcnh7	T	A	2: 62,735,970		probably null	Het
Lrrc72	A	G	12: 36,208,612	V82A	probably damaging	Het
Macf1	A	T	4: 123,378,150	L6535Q	probably damaging	Het
Ncor2	G	C	5: 125,032,132	L585V		Het
Nipal2	G	C	15: 34,578,758	Y298*	probably null	Het
Nipsnap1	C	T	11: 4,882,960		probably benign	Het
Olfr1112	T	A	2: 87,192,132	C148*	probably null	Het
Olfr1267-ps1	T	C	2: 90,085,988	I158V	not run	Het
Olfr578	A	T	7: 102,984,317	Y282*	probably null	Het
Pcdhga4	C	T	18: 37,686,820	T474I	probably benign	Het
Pdp1	G	T	4: 11,960,821	Q516K	possibly damaging	Het
Pik3c2b	C	T	1: 133,090,202	P934L	probably damaging	Het
Pp2d1	A	G	17: 53,515,330	I236T	probably benign	Het
Pygm	G	A	19: 6,388,327	R278H	probably damaging	Het
Rb1	A	T	14: 73,282,923	C215*	probably null	Het
Rgs22	A	G	15: 36,015,643	S1156P	possibly damaging	Het
Rgs9bp	T	C	7: 35,584,701	T174A	probably damaging	Het
Rnf133	A	T	6: 23,649,668	Y130*	probably null	Het
Sctr	G	A	1: 120,022,225	R48Q	probably benign	Het
Serpinb6e	A	T	13: 33,838,940	F153L	probably benign	Het
Slc22a1	A	T	17: 12,666,700	Y200N	probably damaging	Het
Slc22a22	C	A	15: 57,249,711	M377I	probably benign	Het
Slc36a4	A	G	9: 15,722,156		probably null	Het
Slc39a6	A	G	18: 24,601,203	V143A	probably benign	Het
Slf2	G	A	19: 44,938,424		probably null	Het
Sowaha	T	C	11: 53,479,658	K84E	probably benign	Het
Spef2	T	G	15: 9,653,012		probably null	Het
Sphkap	A	T	1: 83,276,678	F1117I	probably damaging	Het
Tas2r113	T	C	6: 132,893,576	I189T	possibly damaging	Het
Tescl	T	C	7: 24,333,822	E26G	possibly damaging	Het
Trpm6	A	T	19: 18,876,786	I1847F	probably damaging	Het
Uba1y	T	A	Y: 822,200	C178S	possibly damaging	Het
Ush2a	T	A	1: 188,443,329	V1208D	possibly damaging	Het
Usp13	G	C	3: 32,894,851	A446P	probably damaging	Het
Usp7	A	T	16: 8,696,724	C722S	possibly damaging	Het
Vmn1r52	A	G	6: 90,179,553	S280G	probably benign	Het
Vmn2r84	T	C	10: 130,389,208	K478E	probably damaging	Het
Zfp112	C	A	7: 24,125,527	L311I	probably benign	Het
Zfp180	G	T	7: 24,105,700	E515*	probably null	Het
Zfp518b	A	G	5: 38,672,328	I778T	probably damaging	Het
Zfp800	A	T	6: 28,243,663	H434Q	probably benign	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- GACGAAGGTGATCAGTCTTTATGG -3'
(R):5'- CCATGTTTGGGTGACAAGTCC -3'

Sequencing Primer
(F):5'- AGGATGGCACTGACTCCAG -3'
(R):5'- CCATATTCTGTCAAATGGAGGTGC -3'

Posted On

2019-06-26