Incidental Mutation 'R7263:Acan'
ID564751
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79092318 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 488 (V488L)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably damaging
Transcript: ENSMUST00000032835
AA Change: V488L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: V488L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGTCACTCAGCATAGAGC -3'
(R):5'- TTTTACCTGACGGTCTGGTC -3'

Sequencing Primer
(F):5'- GCATAGAGCCCAGCTGATC -3'
(R):5'- TGACGGTCTGGTCCTGCAG -3'
Posted On2019-06-26