Incidental Mutation 'R0582:Gm4981'
ID56476
Institutional Source Beutler Lab
Gene Symbol Gm4981
Ensembl Gene ENSMUSG00000075045
Gene Namepredicted gene 4981
Synonyms
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0582 (G1)
Quality Score138
Status Validated
Chromosome10
Chromosomal Location58234848-58236701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58235686 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 235 (S235R)
Ref Sequence ENSEMBL: ENSMUSP00000097314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099726] [ENSMUST00000174056] [ENSMUST00000176875]
Predicted Effect probably benign
Transcript: ENSMUST00000099726
AA Change: S235R

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097314
Gene: ENSMUSG00000075045
AA Change: S235R

DomainStartEndE-ValueType
HOX 5 67 1.13e-11 SMART
internal_repeat_1 86 173 1.27e-12 PROSPERO
internal_repeat_1 177 264 1.27e-12 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000174056
SMART Domains Protein: ENSMUSP00000133909
Gene: ENSMUSG00000075046

DomainStartEndE-ValueType
HOX 2 58 9.45e-5 SMART
HOX 90 152 8.78e-23 SMART
internal_repeat_1 172 207 1.03e-13 PROSPERO
low complexity region 236 247 N/A INTRINSIC
internal_repeat_1 264 299 1.03e-13 PROSPERO
low complexity region 303 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176240
Predicted Effect probably benign
Transcript: ENSMUST00000176875
SMART Domains Protein: ENSMUSP00000145004
Gene: ENSMUSG00000075046

DomainStartEndE-ValueType
HOX 18 80 1.7e-13 SMART
HOX 112 174 1.6e-23 SMART
internal_repeat_1 194 371 2.07e-48 PROSPERO
low complexity region 416 436 N/A INTRINSIC
low complexity region 441 456 N/A INTRINSIC
internal_repeat_1 468 645 2.07e-48 PROSPERO
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Gm4981
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Gm4981 APN 10 58236389 start codon destroyed probably null 0.06
IGL03267:Gm4981 APN 10 58235787 missense probably damaging 0.97
R0021:Gm4981 UTSW 10 58235563 missense probably benign
R1857:Gm4981 UTSW 10 58235780 missense probably benign 0.00
R1858:Gm4981 UTSW 10 58235780 missense probably benign 0.00
R1859:Gm4981 UTSW 10 58235780 missense probably benign 0.00
R1984:Gm4981 UTSW 10 58235963 missense possibly damaging 0.53
R2115:Gm4981 UTSW 10 58236251 missense possibly damaging 0.92
R2197:Gm4981 UTSW 10 58236336 missense possibly damaging 0.71
R3014:Gm4981 UTSW 10 58235534 missense possibly damaging 0.86
R3412:Gm4981 UTSW 10 58236353 missense possibly damaging 0.93
R3983:Gm4981 UTSW 10 58235801 missense possibly damaging 0.95
R4500:Gm4981 UTSW 10 58235706 missense possibly damaging 0.70
R4939:Gm4981 UTSW 10 58235603 missense probably benign 0.33
R5460:Gm4981 UTSW 10 58235895 missense possibly damaging 0.94
R6228:Gm4981 UTSW 10 58235522 missense probably benign 0.02
Z1088:Gm4981 UTSW 10 58235911 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACACCTTGCATTTCGGGAAGTCAC -3'
(R):5'- TGAAGGTTCCCAGGACAGCTTACAG -3'

Sequencing Primer
(F):5'- GCACATCCTTGCTGAAATGG -3'
(R):5'- CAGCTTACAGAGCCTGGATG -3'
Posted On2013-07-11